ID: 1183025828

View in Genome Browser
Species Human (GRCh38)
Location 22:35065460-35065482
Sequence CTCCTGACTCACTCTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183025823_1183025828 3 Left 1183025823 22:35065434-35065456 CCCTCTCTCAGGGTGAGTCCCTC No data
Right 1183025828 22:35065460-35065482 CTCCTGACTCACTCTTCTCAGGG No data
1183025822_1183025828 9 Left 1183025822 22:35065428-35065450 CCTGTTCCCTCTCTCAGGGTGAG No data
Right 1183025828 22:35065460-35065482 CTCCTGACTCACTCTTCTCAGGG No data
1183025824_1183025828 2 Left 1183025824 22:35065435-35065457 CCTCTCTCAGGGTGAGTCCCTCT No data
Right 1183025828 22:35065460-35065482 CTCCTGACTCACTCTTCTCAGGG No data
1183025819_1183025828 29 Left 1183025819 22:35065408-35065430 CCTAAAATGGGGCATCTTTACCT No data
Right 1183025828 22:35065460-35065482 CTCCTGACTCACTCTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183025828 Original CRISPR CTCCTGACTCACTCTTCTCA GGG Intergenic
No off target data available for this crispr