ID: 1183030920

View in Genome Browser
Species Human (GRCh38)
Location 22:35103944-35103966
Sequence CTGTGTGACCCCTGGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183030909_1183030920 7 Left 1183030909 22:35103914-35103936 CCTCTTCCCCAGCAGCCTGGGCC No data
Right 1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG No data
1183030913_1183030920 -8 Left 1183030913 22:35103929-35103951 CCTGGGCCCTGACCGCTGTGTGA No data
Right 1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG No data
1183030910_1183030920 1 Left 1183030910 22:35103920-35103942 CCCCAGCAGCCTGGGCCCTGACC No data
Right 1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG No data
1183030912_1183030920 -1 Left 1183030912 22:35103922-35103944 CCAGCAGCCTGGGCCCTGACCGC No data
Right 1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG No data
1183030911_1183030920 0 Left 1183030911 22:35103921-35103943 CCCAGCAGCCTGGGCCCTGACCG No data
Right 1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG No data
1183030906_1183030920 14 Left 1183030906 22:35103907-35103929 CCTCTCACCTCTTCCCCAGCAGC No data
Right 1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183030920 Original CRISPR CTGTGTGACCCCTGGGAATA GGG Intergenic
No off target data available for this crispr