ID: 1183031727

View in Genome Browser
Species Human (GRCh38)
Location 22:35111444-35111466
Sequence TAGAAACTGAACTTTGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183031727_1183031728 -4 Left 1183031727 22:35111444-35111466 CCTAAAGCAAAGTTCAGTTTCTA No data
Right 1183031728 22:35111463-35111485 TCTACTTTCAAATGACCCTCAGG No data
1183031727_1183031731 18 Left 1183031727 22:35111444-35111466 CCTAAAGCAAAGTTCAGTTTCTA No data
Right 1183031731 22:35111485-35111507 GACTGAGATGTTCATCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183031727 Original CRISPR TAGAAACTGAACTTTGCTTT AGG (reversed) Intergenic
No off target data available for this crispr