ID: 1183032163

View in Genome Browser
Species Human (GRCh38)
Location 22:35114412-35114434
Sequence CAGGAAGTTCCTCTTCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183032163_1183032171 22 Left 1183032163 22:35114412-35114434 CCTTTAGGAAGAGGAACTTCCTG No data
Right 1183032171 22:35114457-35114479 GAAAGAGAGAATCCACCAGCTGG No data
1183032163_1183032169 0 Left 1183032163 22:35114412-35114434 CCTTTAGGAAGAGGAACTTCCTG No data
Right 1183032169 22:35114435-35114457 GGTTTGGTGACCATGAAAGGAGG No data
1183032163_1183032168 -3 Left 1183032163 22:35114412-35114434 CCTTTAGGAAGAGGAACTTCCTG No data
Right 1183032168 22:35114432-35114454 CTGGGTTTGGTGACCATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183032163 Original CRISPR CAGGAAGTTCCTCTTCCTAA AGG (reversed) Intergenic
No off target data available for this crispr