ID: 1183032167

View in Genome Browser
Species Human (GRCh38)
Location 22:35114431-35114453
Sequence CTTTCATGGTCACCAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183032167_1183032171 3 Left 1183032167 22:35114431-35114453 CCTGGGTTTGGTGACCATGAAAG No data
Right 1183032171 22:35114457-35114479 GAAAGAGAGAATCCACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183032167 Original CRISPR CTTTCATGGTCACCAAACCC AGG (reversed) Intergenic
No off target data available for this crispr