ID: 1183032171

View in Genome Browser
Species Human (GRCh38)
Location 22:35114457-35114479
Sequence GAAAGAGAGAATCCACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183032167_1183032171 3 Left 1183032167 22:35114431-35114453 CCTGGGTTTGGTGACCATGAAAG No data
Right 1183032171 22:35114457-35114479 GAAAGAGAGAATCCACCAGCTGG No data
1183032163_1183032171 22 Left 1183032163 22:35114412-35114434 CCTTTAGGAAGAGGAACTTCCTG No data
Right 1183032171 22:35114457-35114479 GAAAGAGAGAATCCACCAGCTGG No data
1183032162_1183032171 30 Left 1183032162 22:35114404-35114426 CCAAGGAACCTTTAGGAAGAGGA No data
Right 1183032171 22:35114457-35114479 GAAAGAGAGAATCCACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183032171 Original CRISPR GAAAGAGAGAATCCACCAGC TGG Intergenic
No off target data available for this crispr