ID: 1183032173

View in Genome Browser
Species Human (GRCh38)
Location 22:35114472-35114494
Sequence CGTGCACGTGGAGCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183032173_1183032178 14 Left 1183032173 22:35114472-35114494 CCAGCTGGAGCTCCACGTGCACG No data
Right 1183032178 22:35114509-35114531 TGTGCAACATCTTTGACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183032173 Original CRISPR CGTGCACGTGGAGCTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr