ID: 1183036130

View in Genome Browser
Species Human (GRCh38)
Location 22:35142277-35142299
Sequence AGTACCAAGGGGAAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183036130_1183036141 11 Left 1183036130 22:35142277-35142299 CCAACCAACTTCCCCTTGGTACT No data
Right 1183036141 22:35142311-35142333 GAGTGTACCCACCAACAGTGGGG No data
1183036130_1183036140 10 Left 1183036130 22:35142277-35142299 CCAACCAACTTCCCCTTGGTACT No data
Right 1183036140 22:35142310-35142332 GGAGTGTACCCACCAACAGTGGG No data
1183036130_1183036139 9 Left 1183036130 22:35142277-35142299 CCAACCAACTTCCCCTTGGTACT No data
Right 1183036139 22:35142309-35142331 GGGAGTGTACCCACCAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183036130 Original CRISPR AGTACCAAGGGGAAGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr