ID: 1183036291

View in Genome Browser
Species Human (GRCh38)
Location 22:35143269-35143291
Sequence CTGAGTCACCACTTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183036281_1183036291 16 Left 1183036281 22:35143230-35143252 CCAAGATGGTTTAGTGATGGGTG No data
Right 1183036291 22:35143269-35143291 CTGAGTCACCACTTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183036291 Original CRISPR CTGAGTCACCACTTGGAGGA GGG Intergenic
No off target data available for this crispr