ID: 1183040108

View in Genome Browser
Species Human (GRCh38)
Location 22:35171594-35171616
Sequence CTGTGTGAGCTACAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183040104_1183040108 -4 Left 1183040104 22:35171575-35171597 CCTCTCCTCCTCAGATGCTCTGT 0: 1
1: 0
2: 2
3: 40
4: 367
Right 1183040108 22:35171594-35171616 CTGTGTGAGCTACAGATGGAAGG 0: 1
1: 0
2: 3
3: 15
4: 208
1183040103_1183040108 -3 Left 1183040103 22:35171574-35171596 CCCTCTCCTCCTCAGATGCTCTG 0: 1
1: 0
2: 3
3: 48
4: 453
Right 1183040108 22:35171594-35171616 CTGTGTGAGCTACAGATGGAAGG 0: 1
1: 0
2: 3
3: 15
4: 208
1183040105_1183040108 -9 Left 1183040105 22:35171580-35171602 CCTCCTCAGATGCTCTGTGTGAG 0: 1
1: 0
2: 1
3: 20
4: 262
Right 1183040108 22:35171594-35171616 CTGTGTGAGCTACAGATGGAAGG 0: 1
1: 0
2: 3
3: 15
4: 208
1183040102_1183040108 13 Left 1183040102 22:35171558-35171580 CCTGCAGGCTTTTCTTCCCTCTC 0: 1
1: 1
2: 5
3: 43
4: 523
Right 1183040108 22:35171594-35171616 CTGTGTGAGCTACAGATGGAAGG 0: 1
1: 0
2: 3
3: 15
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183040108 Original CRISPR CTGTGTGAGCTACAGATGGA AGG Intergenic
900768433 1:4520885-4520907 CTGTGTGTGGTAGAGATGGTGGG - Intergenic
900768474 1:4521080-4521102 CTGTGTGTGGTAGAGATGGTGGG - Intergenic
901051064 1:6426126-6426148 CTGGGTGACCTGGAGATGGAAGG + Intronic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
904963970 1:34357388-34357410 CTGCATGAGCCACATATGGAGGG - Intergenic
907109920 1:51917830-51917852 AGGTGTGAGCCACAGCTGGATGG + Exonic
914385227 1:147162698-147162720 CTGTGGGATCTACAGCTGTAAGG + Intronic
915002073 1:152602787-152602809 CTGTGTGTAAAACAGATGGAAGG - Intergenic
916555107 1:165887782-165887804 CTCTGGGTGCTACAGATGGATGG - Intronic
918100317 1:181367040-181367062 CTTTGGGAGCTACCGATGGGTGG + Intergenic
919832662 1:201552887-201552909 CTGTCTGAGGGTCAGATGGACGG + Intergenic
920053099 1:203175214-203175236 CTGGGAGAGATACAGAAGGAGGG - Intronic
920630791 1:207649573-207649595 ATGTGGGAGCTCCAGATGAATGG + Intronic
922022808 1:221721443-221721465 CTGTGTGAGTTACAGCTGGATGG - Intronic
922788975 1:228299423-228299445 GTGTGTGAGCTGCAGATTCATGG + Exonic
923433714 1:233949038-233949060 ATGTGTGAACTACTGATGGAAGG - Intronic
924125677 1:240848535-240848557 CTGTGTAAGATACAAATGTAAGG + Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063023966 10:2159040-2159062 GTGTATGACCTACAGGTGGAAGG + Intergenic
1063361524 10:5463171-5463193 TTGTGTGAGCTGATGATGGAGGG - Intergenic
1064061059 10:12137546-12137568 CTGTGGGAGATACAGGTAGATGG - Intronic
1067033962 10:42899356-42899378 GTGTGTGTGCTGCAGAAGGAAGG - Intergenic
1067047344 10:42992025-42992047 CAGTGTGAGCTGGAGATGCAGGG - Intergenic
1069266469 10:66464517-66464539 CTTTGTGAGGTAGAGATGGGTGG + Intronic
1069535956 10:69253294-69253316 CTGTCTGTTCTGCAGATGGAGGG + Intronic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069688653 10:70335298-70335320 CTGTGTTACCTCCAGATGCAGGG + Intronic
1069795795 10:71050958-71050980 CTGTGGGAGCTTCAGCTGAAGGG + Intergenic
1070945094 10:80384165-80384187 CTCTGTAAGCTCCAGAGGGATGG - Intergenic
1071019476 10:81035318-81035340 ATGTTTGAACTTCAGATGGAGGG + Intergenic
1072986031 10:100141544-100141566 CTGTGGGAAATACAGAGGGATGG - Intergenic
1075486549 10:122827075-122827097 CTGTCTGAGCTGCTGATGCAGGG + Intergenic
1078293421 11:10039950-10039972 CTGTTTGAGCTACAGATACATGG - Intronic
1078501190 11:11879273-11879295 CTATGTGAGGTAAAGAGGGAAGG + Intronic
1078703239 11:13711188-13711210 CTTTGTGATCTACAGAGGAAGGG - Intronic
1079136849 11:17780266-17780288 CTGTGGGTGCTGCGGATGGAAGG - Intronic
1079180180 11:18186067-18186089 CTGAGAGGGCTACAAATGGATGG + Intronic
1079472675 11:20794504-20794526 CTGGGTGTGCTACACATGGGAGG + Intronic
1082796306 11:57380523-57380545 CTGTATCAGCTAAAGAGGGAAGG + Intronic
1085055957 11:73403944-73403966 CTGTGTGGGGATCAGATGGAGGG + Intronic
1086079536 11:82889110-82889132 CTTTGTGAGGTACAGGTGGAAGG + Intronic
1086346207 11:85900143-85900165 CTGTGTGTGCTATAGATGGTGGG + Intronic
1088879568 11:113962926-113962948 CTGTGCAAGCAACAGAAGGAAGG + Intergenic
1090270208 11:125380731-125380753 CTGTGTGAGCCAGGGATGGGTGG - Intronic
1091661073 12:2384101-2384123 GTGTGTGATCCACAGAAGGAAGG - Intronic
1095241132 12:39860101-39860123 CTGTGTTAGCTAAAAAAGGAAGG + Intronic
1099034210 12:77565096-77565118 CTGTGGGAACTATAGCTGGAAGG - Intergenic
1099138442 12:78938803-78938825 GTGTGTGAGCTACACAAAGACGG - Intronic
1100230576 12:92602420-92602442 ATGTGTGTACTGCAGATGGAAGG + Intergenic
1105416283 13:20214603-20214625 CTCTGTGAGCGACTGATGAAGGG + Intergenic
1105917274 13:24928212-24928234 CTGGCTGAGCAACAGATGAAAGG - Intergenic
1107015402 13:35704859-35704881 CTGGGTGAGCTAGTGAGGGAAGG + Intergenic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1108588267 13:51890091-51890113 CAGAGTGAGCTACAAATGCAAGG + Intergenic
1109297712 13:60554697-60554719 CTGTTTTAGCTACAGCTGAATGG + Intronic
1110569049 13:76984970-76984992 TTGTGTGAGGTTCAGGTGGAAGG + Intergenic
1110814876 13:79850098-79850120 CTGTGTGAAATACAGCTTGAGGG - Intergenic
1113784511 13:112995469-112995491 CTGTGTGAGCTGCTGCTGGGTGG + Intronic
1113900337 13:113793424-113793446 CTGCGTGAGTTACAGAGAGATGG - Intronic
1114190463 14:20436315-20436337 CTGTATGACCTACAGGTGGAAGG - Intergenic
1115145198 14:30218287-30218309 CTTTATGAGCTTCAAATGGATGG + Intergenic
1118210048 14:63757551-63757573 CTGTGTAAGCAACAGAAAGAGGG - Intergenic
1119580832 14:75779048-75779070 CTCTGTGGGCTACATATGGGTGG + Intronic
1120294259 14:82621205-82621227 ATGTCTGACCTACAGATGTATGG - Intergenic
1121601590 14:95208898-95208920 CTGAGTGAGTGACAGATGGGTGG - Intronic
1123170287 14:106366832-106366854 CTGTGTGAGAGAGAGAAGGAGGG + Intergenic
1124170468 15:27368096-27368118 CTATGAGACCTACAGCTGGATGG - Intronic
1126541881 15:49832848-49832870 CTGGCTGAGCAACAGATGAAAGG - Intergenic
1126543257 15:49844735-49844757 CTGGCTGAGCGACAGATGAAAGG - Intergenic
1127075661 15:55323003-55323025 GTGGGTCAGCTACAGATGGAGGG - Intronic
1127591113 15:60424471-60424493 CTGTGTGAGCTAGAAAGTGAGGG - Intronic
1130759980 15:86808956-86808978 ATGTGTGAGATACTGATGAATGG + Intronic
1130905995 15:88241314-88241336 CTGAGTGAGTGACAGAAGGAGGG + Intronic
1133410909 16:5568073-5568095 GTTTGTGAGCTAGAGAAGGATGG - Intergenic
1135095715 16:19563006-19563028 CTTTGGGAGGTACAGATGGGTGG - Intronic
1136073700 16:27804317-27804339 CTGTGTGTCCGACAGCTGGAAGG - Intronic
1137066848 16:35855702-35855724 CTGGGTGAGCAACGGATGAAAGG - Intergenic
1137711747 16:50571563-50571585 CTCTCTGAGCAACAGATGAATGG - Intronic
1139438411 16:66949978-66950000 CTGTGTGAGGCAGAGATGGGAGG + Intergenic
1139469599 16:67170981-67171003 CTGTGTGAGCCTCAAAGGGAGGG + Intronic
1139829787 16:69788027-69788049 CTGTGTGACCAACAGACTGAAGG - Intronic
1140394500 16:74615140-74615162 CTGTGTGAAGTACAGAGGGAGGG + Intergenic
1141319033 16:82989399-82989421 CAGTGTGAGCTGGAGAGGGATGG + Intronic
1141503488 16:84460431-84460453 CTGTCTGCGGGACAGATGGAGGG + Intronic
1142441440 16:90100882-90100904 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1142994721 17:3753823-3753845 GTGTTTGAGCTCCAGAAGGAGGG - Exonic
1144796288 17:17893412-17893434 CTTTGTGAGCAGCAGAGGGATGG + Intronic
1147020804 17:37531122-37531144 CTGTGGGAGGTTGAGATGGAAGG + Intronic
1149447107 17:56721894-56721916 ATGAGGGAGCTACAGATGGAAGG + Intergenic
1150040424 17:61854461-61854483 CTTTGTGAGGCACAGATGGGTGG + Intronic
1150187076 17:63194016-63194038 CTGCCTCATCTACAGATGGAGGG - Exonic
1152657299 17:81525954-81525976 CTGTGTGAGCTAAACAGGGGAGG - Intergenic
1155265424 18:24088418-24088440 CTGAGTGAGCTCCAGATATATGG + Intronic
1160181228 18:76638405-76638427 CTGTGTGCCCTAGAGAAGGAGGG - Intergenic
1160408873 18:78661284-78661306 TAGTGTGTGCTACAGATGGGAGG - Intergenic
1161909803 19:7184610-7184632 CCGTGTGACTTACAGATGGTCGG + Exonic
1163603142 19:18260548-18260570 CCGTGTGGGCCACAGATGGTGGG + Intronic
1164221717 19:23200783-23200805 CTTTGTGAGCTCCAGGTGGGTGG + Intergenic
1164927858 19:32144235-32144257 CTGTGCGAGCTGCAGAAGGTTGG - Intergenic
1165971650 19:39636882-39636904 CTGTGTGAGGTACAGGTGATTGG - Intergenic
1166337643 19:42117884-42117906 CTCTGTGTGATACAGATGAAGGG - Intronic
1167153375 19:47722957-47722979 CTGAGTGAGCTCTAGCTGGAGGG + Intronic
1167260233 19:48454092-48454114 CAGAGTGAGTTCCAGATGGAAGG - Exonic
1167812577 19:51847531-51847553 CTGGGAGAGCCACCGATGGAGGG - Intergenic
1168415668 19:56166591-56166613 CTGTGTGAGCTACAATATGAAGG + Intergenic
926958376 2:18327421-18327443 CTGTGATAGCTACTGGTGGACGG + Intronic
927863184 2:26573230-26573252 CTTAGTGAGCTCCAGAAGGAGGG + Intronic
930105609 2:47636897-47636919 CGGTGAGAGCTCAAGATGGATGG - Intergenic
930441507 2:51413720-51413742 CTGTGTTGACTTCAGATGGAGGG + Intergenic
930455242 2:51600162-51600184 CTGTGGGGGCTACAGGGGGAAGG - Intergenic
931494777 2:62792236-62792258 TTATGTGAGCTACAGAATGATGG + Intronic
932739185 2:74278908-74278930 CTGTAGGAGCTGCAGATGGCTGG - Intronic
934142591 2:89062302-89062324 CTGTGTGAGCATCACATGGCAGG - Intergenic
934147307 2:89108113-89108135 CTGTGTGAGCATCACATGGCAGG - Intergenic
934221965 2:90092481-90092503 CTGTGTGAGCATCACATGGCAGG + Intergenic
934226652 2:90138252-90138274 CTGTGTGAGCATCACATGGCAGG + Intergenic
935131873 2:100266656-100266678 TTGTGTGAGCTGCACATAGATGG - Intergenic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
943815813 2:192252826-192252848 ATGTGTGAGTTACAGAGAGAAGG + Intergenic
946022495 2:216650642-216650664 CTGTGGTAGCTGCAGGTGGAGGG + Intronic
946987868 2:225293162-225293184 CTTTATGACCTACAGATGGAAGG + Intergenic
947914092 2:233820586-233820608 CTGTGTGTGCTACAGCATGATGG + Intronic
1170454091 20:16516570-16516592 CTCTGTCAGCTCCAGATGAAGGG + Intronic
1172888848 20:38249522-38249544 CTGTGTGGGCTACGGGTGGGAGG - Intronic
1172964495 20:38824783-38824805 CTTTGTGAGGCAAAGATGGATGG + Intronic
1173295353 20:41750415-41750437 CTGTATGGGCTGCAGCTGGACGG + Intergenic
1174978483 20:55362846-55362868 CTGTGTGAGCTGTAGCTGGGAGG - Intergenic
1175205094 20:57305234-57305256 CTGTGTGAGCCACAGTGAGAAGG + Intergenic
1175690047 20:61058510-61058532 CTCTGAGAGCTTCAGATGAACGG + Intergenic
1176073329 20:63237807-63237829 CTATGAGAGCTTCAGCTGGAGGG - Intronic
1177758162 21:25372466-25372488 CTGTGTGAATTAGAGGTGGATGG + Intergenic
1177777372 21:25583193-25583215 CTGTCTGAGCCACAGCTGCAAGG + Intergenic
1180033445 21:45228581-45228603 CTGTGTTGGCTTCAGATGTAGGG + Intergenic
1180741463 22:18055979-18056001 CTCTGGGAGCTAGAGATGAAAGG - Intergenic
1182747192 22:32615109-32615131 CTTTGAAAGCTACAGATGGGAGG + Intronic
1182963059 22:34494493-34494515 CTGAGTGGGCTCCAGATGCACGG - Intergenic
1183040108 22:35171594-35171616 CTGTGTGAGCTACAGATGGAAGG + Intergenic
1184243536 22:43223904-43223926 CTGTGTGGGTTACAGAAGGGAGG - Intronic
949341447 3:3035062-3035084 CTGTGGGAGGTAGAGTTGGATGG + Intronic
951576505 3:24120143-24120165 CTCTGTCAGCTTCAGAAGGAAGG + Exonic
952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG + Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
959111637 3:102129799-102129821 CTGTCTGAGATACAGGTAGAAGG - Intronic
962602107 3:137000265-137000287 CTGTGTGAGGTACAGGTGTGGGG - Intronic
963307633 3:143670818-143670840 CTGTAGGAGCTACTGAGGGAAGG - Intronic
966415900 3:179689271-179689293 TTGTGTGAGCATCAGATGAATGG + Intronic
966767951 3:183479225-183479247 CTCTGTGAGGGAGAGATGGAGGG - Intergenic
967422167 3:189285387-189285409 CTGTGTGTTTTAGAGATGGAAGG + Intronic
968276235 3:197442417-197442439 CTGTGGGAGGTCGAGATGGAAGG + Intergenic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
969174185 4:5386164-5386186 CTGTGTGAGAGACAGACGGCTGG - Intronic
969174753 4:5390024-5390046 CTCTGTGGGCTCCAGAAGGAAGG + Intronic
970029637 4:11660305-11660327 CTGTGTGATTTGCAGATGAAGGG - Intergenic
970408782 4:15787705-15787727 CTGGCTGAGCGACAGATGAAAGG + Intronic
971318751 4:25588478-25588500 CTTTGTGATCCACAGATGAAAGG - Intergenic
973863349 4:55087404-55087426 CAGCGTGGGCTACAGATGGGAGG + Intronic
974619857 4:64340858-64340880 CTTTATGGGCTTCAGATGGAAGG - Intronic
975480640 4:74876368-74876390 TTCTGTGAACTACAGAGGGAAGG - Intergenic
980156226 4:129110378-129110400 ATGTGAGAGCTACAGGTGCAAGG - Intronic
980274458 4:130631581-130631603 CTGTGTGAGGTATACATGTAAGG - Intergenic
980283432 4:130752514-130752536 CAGTGTGGGATACTGATGGAAGG + Intergenic
980889376 4:138797706-138797728 GTGTGTGAGTGACAGAGGGAGGG + Intergenic
981413811 4:144464104-144464126 CTGTGTGAGCAACACAGGCATGG + Intergenic
982263370 4:153515972-153515994 CTGTGTGAGGTCAAGATGGGAGG - Intronic
983832550 4:172346344-172346366 CTGTGTGAGGGACATATTGAAGG - Intronic
985495168 5:200052-200074 CTGGGTGAGCTCCAGATTCACGG - Exonic
985817861 5:2139786-2139808 CTGAGTAAGCTGCAGATGCAGGG - Intergenic
986163826 5:5255400-5255422 CTCTGAGAGCTACAGATGTCTGG - Intronic
986571810 5:9173518-9173540 CTATGTGAGACACAGAAGGAAGG - Intronic
990376284 5:55173643-55173665 CTGTGTCAGCTATAGATGTGAGG + Intergenic
990938687 5:61177917-61177939 CTGTTTCAGTTTCAGATGGAGGG - Intergenic
993151942 5:84173266-84173288 CTGTGGGAGCCACAGTTGGTGGG + Intronic
994013560 5:94938038-94938060 CTGTCAGAGGTAGAGATGGAGGG - Intronic
994589318 5:101754240-101754262 CTGGCTGAGCTACAGGTGGCAGG + Intergenic
996480745 5:123972685-123972707 CTGGGTGGGATACAGTTGGATGG + Intergenic
996605490 5:125315783-125315805 CTGTATTAGCCACAGATTGAGGG - Intergenic
998928820 5:147157714-147157736 TTTGGTGAGCTAAAGATGGAGGG - Intergenic
1004978928 6:21000562-21000584 GTGTGTCATGTACAGATGGAAGG - Intronic
1005070371 6:21856810-21856832 CTTTGTGAGCTGAAGATGGAGGG + Intergenic
1005530875 6:26704496-26704518 GTGTGTGAAATACACATGGAGGG - Intergenic
1005539921 6:26797150-26797172 GTGTGTGAAATACACATGGAGGG + Intergenic
1005915094 6:30344770-30344792 CTGTAAGATCTACAGACGGAAGG - Intronic
1006338452 6:33432856-33432878 CTGTGTGAGATGCAGAGGGAGGG + Intronic
1009012738 6:57862066-57862088 GTGTGTGAAATACACATGGAGGG + Intergenic
1010033540 6:71294429-71294451 CAGTGTGAGTCACAGAAGGAAGG + Intronic
1010982512 6:82385213-82385235 CTGTGTTGGCTCCAGATAGATGG + Intergenic
1011008708 6:82678659-82678681 CAGTGCCAGCTACAGAAGGATGG + Intergenic
1017492608 6:154957635-154957657 ATTTGAGAGCTACAGATGAAAGG - Intronic
1017561838 6:155636494-155636516 GTCTGTGGGCTGCAGATGGAGGG + Intergenic
1018159311 6:161022582-161022604 CAGTGTGAGCTACAAGTGAATGG + Intronic
1018309606 6:162494202-162494224 CTGTGTAAGCTGCAGAATGAAGG - Intronic
1019253983 7:36864-36886 CTGTGTGGGCAACAGAAGGAAGG + Intergenic
1019925997 7:4192160-4192182 CTGTGTCAGTTACAGATGGAAGG + Intronic
1023606058 7:41932117-41932139 CTGTGTGGGGGACAGAGGGAGGG + Intergenic
1024135000 7:46397666-46397688 GTGTGTTTGGTACAGATGGATGG + Intergenic
1026104781 7:67412114-67412136 CTCTGTGGGCTGCAGATGGTGGG + Intergenic
1027513803 7:79116113-79116135 CTAGGTGAGCTAAAGATTGAAGG + Intronic
1028825795 7:95272033-95272055 ATGTGTGAGATAAAGATGTAAGG + Intronic
1030309277 7:108053355-108053377 CTGGGTAAACTACAGGTGGAAGG - Intronic
1030958493 7:115885789-115885811 CTGTGAGATATTCAGATGGAGGG - Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033158386 7:138975703-138975725 CATTGTGAGCTCCAGATGAAAGG + Intronic
1033242737 7:139694226-139694248 CTGTGAGAGTTACAGGAGGATGG - Intronic
1033415937 7:141161303-141161325 CTGAGGGAGCCACAGAGGGAGGG + Intronic
1033870049 7:145742119-145742141 CTGAGTTTGCTACAGCTGGAAGG - Intergenic
1035483914 7:159207663-159207685 CTGTATGAGCTACATTTAGATGG + Intergenic
1038336934 8:26653126-26653148 CTGTGAGATCTAGGGATGGAGGG - Intronic
1039598204 8:38809760-38809782 GTGTGGGACCTACAGAAGGAGGG + Intronic
1041403814 8:57473910-57473932 CTGTTTGAGCCACAGCTGGGTGG + Intergenic
1044468937 8:92542391-92542413 CTGAATGAGTTACAGAGGGAGGG - Intergenic
1044843890 8:96361322-96361344 CTGGGAGAGCTAGAGAAGGATGG - Intergenic
1045189330 8:99867352-99867374 CTGAGGCAGCTACAGATGAAAGG - Intronic
1047628290 8:126678878-126678900 CTGTGTGAGATTCAAAAGGAAGG - Intergenic
1052006214 9:23352195-23352217 GTGTGGGAGCTGCAGATGGTTGG - Intergenic
1052574695 9:30277595-30277617 GTGTGGAACCTACAGATGGAGGG + Intergenic
1052820839 9:33137021-33137043 CTGGGTCAGCTACGGAGGGAGGG - Intronic
1054787336 9:69221793-69221815 CTGTGAGAGATTCAGGTGGACGG - Intronic
1056911162 9:90702107-90702129 TGGTGTTAGCTACAAATGGAAGG + Intergenic
1058382135 9:104389016-104389038 CTCTGTGAGCTCCCAATGGAAGG - Intergenic
1060662384 9:125411857-125411879 CTGTGTGAGCCACAGTTTTATGG + Intergenic
1060974841 9:127758842-127758864 CTGTGGGAGCTCCAGAGGTAGGG - Intronic
1062746415 9:138215679-138215701 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1186884870 X:13903193-13903215 CTGCGTGGGAGACAGATGGAAGG - Intronic
1188659904 X:32746359-32746381 CTGTGTGAGATTCTGCTGGATGG - Intronic
1189028438 X:37424607-37424629 CTTTATGAGGTACAGAAGGAAGG - Intronic
1192559020 X:72113258-72113280 CTGTGTGGGAAACAGATGGGAGG + Intergenic
1195393633 X:104388337-104388359 ATATGTAGGCTACAGATGGAAGG - Intergenic