ID: 1183043151

View in Genome Browser
Species Human (GRCh38)
Location 22:35198381-35198403
Sequence CAGGGTGAAGAAGGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183043151_1183043161 24 Left 1183043151 22:35198381-35198403 CCCTCTCCCCCTTCTTCACCCTG No data
Right 1183043161 22:35198428-35198450 AATCATTCTCCCCACCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183043151 Original CRISPR CAGGGTGAAGAAGGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr