ID: 1183043750

View in Genome Browser
Species Human (GRCh38)
Location 22:35203295-35203317
Sequence CAGAAGGACTGCTGGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183043750_1183043754 5 Left 1183043750 22:35203295-35203317 CCAACTGCCCAGCAGTCCTTCTG No data
Right 1183043754 22:35203323-35203345 ATGCCAGCCTGAGTTTCCTTTGG No data
1183043750_1183043755 6 Left 1183043750 22:35203295-35203317 CCAACTGCCCAGCAGTCCTTCTG No data
Right 1183043755 22:35203324-35203346 TGCCAGCCTGAGTTTCCTTTGGG No data
1183043750_1183043759 28 Left 1183043750 22:35203295-35203317 CCAACTGCCCAGCAGTCCTTCTG No data
Right 1183043759 22:35203346-35203368 GAAACCTGCTCTTCATTCTCTGG No data
1183043750_1183043760 29 Left 1183043750 22:35203295-35203317 CCAACTGCCCAGCAGTCCTTCTG No data
Right 1183043760 22:35203347-35203369 AAACCTGCTCTTCATTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183043750 Original CRISPR CAGAAGGACTGCTGGGCAGT TGG (reversed) Intergenic
No off target data available for this crispr