ID: 1183054123

View in Genome Browser
Species Human (GRCh38)
Location 22:35291405-35291427
Sequence CAGGGGTTTTTACAGTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183054123 Original CRISPR CAGGGGTTTTTACAGTGGAA AGG Intronic
903661699 1:24982462-24982484 CAGGGGCTGTAACTGTGGAAGGG + Intergenic
904701086 1:32358498-32358520 CAGTGGCTCTTCCAGTGGAAAGG + Intronic
906317794 1:44799637-44799659 CGGGGGTATTTTCAGAGGAAGGG + Intergenic
908765547 1:67551753-67551775 CAGAAGTTTTTCCAATGGAAGGG - Intergenic
909524889 1:76612000-76612022 CAGGTGTCTTTACTGTGGAATGG - Intronic
909913791 1:81292869-81292891 CAAGAGTTTGTACAGTGGGAGGG + Intergenic
910365949 1:86465720-86465742 CAGTATTTTTTACAGTGGAATGG + Intergenic
913038153 1:114994884-114994906 CAGGGGTTGTTAGAGATGAAGGG - Exonic
913691332 1:121282526-121282548 AAGGCGTTTTTAGGGTGGAAAGG - Intronic
914146211 1:144997455-144997477 AAGGCGTTTTTAGGGTGGAAAGG + Intronic
915122888 1:153642666-153642688 CAGGGTGTTTTAAAATGGAATGG - Intronic
916902571 1:169245222-169245244 CAAGTGTTTCTACAGTGTAAGGG - Intronic
919280775 1:195485813-195485835 CAGGGTTTTATTCGGTGGAAAGG + Intergenic
920031666 1:203041144-203041166 CAGAGGTTTTTCCAGGGGGAGGG + Intronic
920478656 1:206301002-206301024 AAGGCGTTTTTAGGGTGGAAAGG - Intronic
920506849 1:206521305-206521327 CAGGCTTTTTTGCAGTGGGAAGG - Intronic
923964269 1:239119240-239119262 CTGGGGCTTTTGCAGTGGGAAGG + Intergenic
924273969 1:242365952-242365974 CTGGAGTTTTTACTGTGGGAAGG - Intronic
1065595774 10:27309578-27309600 CAGTGATCTTTACAGAGGAAGGG + Intergenic
1068756157 10:60656135-60656157 CAGGGGTTTTGTTTGTGGAAAGG + Intronic
1069679895 10:70277006-70277028 CCAGAGTTTTTACAGTAGAATGG + Intronic
1075071206 10:119320934-119320956 GAGGAATTTTTACAGTGGCATGG + Intronic
1078041891 11:7873032-7873054 CAGGTCTTTTGACAGTGCAAAGG + Intergenic
1079324687 11:19481387-19481409 CAGGGGCTTTTACAGAGCATTGG - Intronic
1080279610 11:30541549-30541571 CTGAGGATTTTAAAGTGGAATGG - Intronic
1081011665 11:37820686-37820708 CAGTGCTGTTTATAGTGGAAAGG - Intergenic
1084943411 11:72626244-72626266 CAGGGGTGTGGACAGTGGATGGG + Intronic
1085746228 11:79116860-79116882 CAGGGCTTTTTAAAGAGAAATGG + Intronic
1087408225 11:97756008-97756030 CAGGGGTGTTTAAAGTGAAATGG - Intergenic
1090137622 11:124214970-124214992 TAGGGGTAATGACAGTGGAATGG - Intergenic
1090140187 11:124249891-124249913 TAGGGGTAATGACAGTGGAATGG - Exonic
1090141183 11:124265147-124265169 TAGGGGTAATGACAGTGGAATGG - Exonic
1090537841 11:127664226-127664248 CAGGGGTTTCTCTAGTGGCATGG - Intergenic
1090930617 11:131295175-131295197 CAGGGGTTTTAACCCTGGATGGG + Intergenic
1096207672 12:49737037-49737059 CTGTTGTTTGTACAGTGGAAAGG + Intronic
1097294017 12:57943750-57943772 TAGCTGTTTTTACAGTGGAAGGG + Intronic
1101883503 12:108641863-108641885 CAGGCCTGGTTACAGTGGAAAGG - Intergenic
1104462550 12:128967516-128967538 CAGGTTTTTTTCCAGGGGAAGGG - Intronic
1109788879 13:67221401-67221423 CATGTATTTTTACAGTGTAAAGG - Intronic
1110774325 13:79389601-79389623 CAGGGGTGTTCAGAGTGGTATGG + Intronic
1111624174 13:90762685-90762707 CTGGAGTGATTACAGTGGAAAGG + Intergenic
1111785074 13:92776388-92776410 CAGGGGTTTTTATAATGGAAAGG - Intronic
1112779199 13:102879573-102879595 CAGGGATCTTTCCAGTGGCATGG + Intergenic
1116641031 14:47463224-47463246 AAGGAATTTTTTCAGTGGAATGG - Intronic
1116750049 14:48871507-48871529 CAGGGGTTCTTTCAGTCCAAAGG - Intergenic
1117870558 14:60196239-60196261 CATGGTCTTTCACAGTGGAAAGG - Intergenic
1118438290 14:65790834-65790856 CAGGGGAGTTTATAGTGCAATGG + Intergenic
1119195759 14:72715668-72715690 CCGGGGACTTCACAGTGGAAAGG + Intronic
1120678650 14:87452717-87452739 CAAGGGTTTTTACAGCAGCATGG - Intergenic
1121061721 14:90916258-90916280 CAGGGATTCTTACAGAGAAAGGG + Intronic
1126302949 15:47220435-47220457 CAAGCCTTTCTACAGTGGAAAGG + Intronic
1127823544 15:62682904-62682926 CTGGTGTTTTTACAGTTGAGGGG - Intronic
1129852609 15:78802574-78802596 GAGGGGTTTTTAAACTGCAAGGG - Intronic
1130250373 15:82296493-82296515 GAGGGGTTTTTAAACTGCAAGGG + Intergenic
1132015091 15:98308277-98308299 CAGGGGATGTTAGAGTGGGAGGG + Intergenic
1132206762 15:99991695-99991717 CATGTGTCTTTATAGTGGAATGG - Intronic
1132832067 16:1933292-1933314 CAGGGGATGCTACAGTTGAATGG - Intergenic
1137455488 16:48614648-48614670 CAGGGGTTTTTAAAGAGAGAGGG - Intronic
1139583258 16:67885506-67885528 CTGGGATTTGTACAGGGGAAGGG - Intronic
1139588965 16:67922627-67922649 CAGGAGTTTATAAACTGGAAGGG + Intronic
1139624826 16:68178733-68178755 GATGAATTTTTACAGTGGAAAGG - Intronic
1141272107 16:82550400-82550422 CAGAGCTCTTTACAGGGGAAAGG + Intergenic
1141863747 16:86735735-86735757 CAGGGTAATTTACAATGGAAAGG + Intergenic
1145790599 17:27624317-27624339 AAAGGGTTTTTACAGTGCCAGGG - Exonic
1148533972 17:48422290-48422312 CTGGGAGTTTTACTGTGGAAAGG + Intronic
1148575739 17:48709717-48709739 CAAGGGTTTTTCCAGTGGCTGGG - Intergenic
1152208417 17:78989495-78989517 CAGGGGTTTTCACAGTGTGACGG + Intergenic
1154042062 18:10865718-10865740 CAGGGGTATTTACAATTTAAAGG + Intronic
1154171001 18:12049973-12049995 CAGGTTTTTTAACAGAGGAAGGG - Intergenic
1155116843 18:22777236-22777258 CATGGGCTTTTAAAGTGGAGAGG - Intergenic
1155491824 18:26407482-26407504 CAGAGGTTTGTTCAGAGGAAGGG + Intergenic
1156489374 18:37487229-37487251 CAGGAATTTCTACATTGGAAGGG - Intronic
1158523612 18:58193026-58193048 CAAAGGTTTTTACAGTGAAGTGG + Intronic
1161372591 19:3921574-3921596 CATGGTTTATTACAGTAGAAGGG + Intronic
1163108703 19:15143667-15143689 CCATGGTTTTTGCAGTGGAAGGG + Intergenic
1165007011 19:32815462-32815484 CAGAGGTTTTTAAACTGGAAAGG - Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
927943821 2:27122804-27122826 CAGGGGTTTTAAGAAGGGAAGGG - Intergenic
933140428 2:78785945-78785967 CAGGTTTTATTACAGTGAAAAGG - Intergenic
934649231 2:96080512-96080534 CATGTGTCTTTACAGTAGAATGG + Intergenic
935146962 2:100402198-100402220 CATGGGGTTTTAGAGTGAAAGGG - Intronic
936685884 2:114826102-114826124 CAGGTATTTTTCCATTGGAAAGG - Intronic
936947561 2:117944351-117944373 CATAGGTTTTTGCAGGGGAAGGG - Intronic
939215349 2:139230524-139230546 CACAGGCTTCTACAGTGGAATGG - Intergenic
941711241 2:168715553-168715575 CTAAGGTTTTTACAGTGGAAAGG + Intronic
941744960 2:169077634-169077656 CAGGGGTTTCTACATTTGGATGG - Intronic
941992838 2:171573822-171573844 CAGGTGTTTTTCCAATGAAAAGG - Intergenic
943760905 2:191607737-191607759 CAAAGGTTTTCACAATGGAATGG + Intergenic
944278539 2:197868040-197868062 CAAGGATTTTTACAATTGAAAGG + Intronic
948442574 2:238004772-238004794 CAGGGATCCTTAAAGTGGAAAGG + Intronic
948509739 2:238455847-238455869 CACCGGTTTTTACACTGGGAAGG + Intergenic
948912062 2:241009757-241009779 AAGGGGTTGTTCCAGTGGGAGGG - Intronic
1172417505 20:34782928-34782950 AAGGGTTATTAACAGTGGAATGG + Intronic
1173152203 20:40577179-40577201 CAAGGGTGTTTCCAGTGGATGGG + Intergenic
1178340667 21:31783506-31783528 GAGGGGATTTTACAGTTGGAGGG - Intergenic
1181667843 22:24410753-24410775 CAGGTGTCATTACAGTGAAAAGG + Intronic
1182220589 22:28755500-28755522 CAGGAGTGGTTACTGTGGAAGGG - Intronic
1183054123 22:35291405-35291427 CAGGGGTTTTTACAGTGGAAAGG + Intronic
1184599508 22:45534405-45534427 CATGTGTTTATGCAGTGGAAGGG - Intronic
949978783 3:9486068-9486090 GATGAATTTTTACAGTGGAATGG - Intergenic
955503402 3:59607164-59607186 CAAGGATTTTTAGTGTGGAAGGG + Intergenic
958077687 3:88704257-88704279 GATGGGTATTTACTGTGGAATGG + Intergenic
960025742 3:113007200-113007222 GAGGGGTTTTTACATTGAGATGG - Intronic
960354501 3:116634657-116634679 AAGGGGTTTTTAGACTGGATAGG + Intronic
961718392 3:128874957-128874979 CATGGATTTTCCCAGTGGAATGG + Intergenic
961719233 3:128881358-128881380 CATGGATTTTCCCAGTGGAATGG - Intronic
962181552 3:133211263-133211285 CTGATGTTTTTACAGTAGAAAGG - Intronic
962631866 3:137284747-137284769 AAGGCATTTTTACATTGGAAAGG + Intergenic
964374586 3:156036598-156036620 CTGGGATATTCACAGTGGAAGGG + Intergenic
964452354 3:156824486-156824508 AAGGGAAATTTACAGTGGAAAGG + Intergenic
965936375 3:174118158-174118180 CAGGGATTTTTTAAGTGGAATGG + Intronic
965979703 3:174672918-174672940 CAGTGGCTTGTACAGTGAAAGGG + Intronic
966363292 3:179152813-179152835 CTGGGTGTTTGACAGTGGAATGG - Intronic
970171710 4:13297075-13297097 TAGGGGTTTTTAAAGTCAAATGG - Intergenic
973689789 4:53415140-53415162 CAGGGGTTTTTGCACTGTAGTGG - Intronic
974730565 4:65859487-65859509 CAGAAGTTTTTTCAGAGGAAAGG - Intergenic
977160124 4:93623508-93623530 CATGTGTCTTTACAGTAGAATGG - Intronic
977613808 4:99064922-99064944 AAGGTATTTTTACAGTGAAAAGG - Intergenic
978006375 4:103622191-103622213 CAAGGGTGGTTTCAGTGGAATGG + Intronic
981091063 4:140732751-140732773 CAGGGTTTTTTTTGGTGGAAAGG + Intronic
981634960 4:146866477-146866499 CAGGGGCTTTTTAAGTGCAAAGG - Intronic
983375966 4:166928518-166928540 CAGGGGTTATTAGGGAGGAAAGG + Intronic
987994244 5:25254167-25254189 CAGGAGGTGTTACAGAGGAATGG + Intergenic
988161871 5:27528606-27528628 CAGGGATTTTTGCAGTTGATAGG + Intergenic
989774257 5:45183996-45184018 CAGGAGTTTTTATAGTGAGAGGG - Intergenic
990154218 5:52856476-52856498 AAGGTGTTTTTATAGTGGATGGG - Intronic
994438551 5:99770067-99770089 CACGTGTTTTTATAGTAGAATGG - Intergenic
995038813 5:107565117-107565139 CAGAAGGTTTTTCAGTGGAAAGG - Intronic
995292798 5:110478000-110478022 TAGGTGTTATTATAGTGGAAAGG + Intronic
996934211 5:128929426-128929448 CAGGATTTTTGACAGTAGAAGGG - Intronic
997261079 5:132465888-132465910 CAGTGGTTTTTAAAGGGGGAGGG + Intronic
998011032 5:138695815-138695837 CAGGGCTTCTTACACAGGAAGGG - Intronic
1001256394 5:170186729-170186751 CAGGGCCTATTACAGTGGAAAGG + Intergenic
1002427967 5:179186902-179186924 GAGGGTTTTAGACAGTGGAAGGG - Intronic
1007344302 6:41216744-41216766 CAGGGATTTTAACACTGGGAGGG - Intergenic
1007346084 6:41230129-41230151 CAGAGGTTTTAACACTGGGAGGG + Intronic
1014217444 6:118766440-118766462 CAAGGGTCTTTACAGAGGAAAGG - Intergenic
1019457335 7:1137267-1137289 CAGGGGTTTTGAGAATGGAAAGG - Intronic
1021669501 7:23021114-23021136 CAGGGGTTTTGATAATGGGATGG - Intergenic
1022662348 7:32378794-32378816 TAGGGGTTTTTCAAGGGGAAGGG - Intergenic
1023150190 7:37194754-37194776 CATGAGATTTTACAGTGGAGAGG - Intronic
1024678402 7:51658820-51658842 CAAGGGTCTCTACAGTGGCAAGG + Intergenic
1028524413 7:91767884-91767906 CAGGGGTTTTTTGGGTGAAACGG + Intronic
1031554322 7:123153394-123153416 GAGGAGTTTTTGAAGTGGAATGG + Intronic
1032164685 7:129536326-129536348 CAGAGGGTTTAACAATGGAATGG - Intergenic
1032885851 7:136137303-136137325 CAGGGGTGATCAGAGTGGAAGGG + Intergenic
1035234369 7:157487117-157487139 CAGGGGCTCTAACAGTGGAGAGG - Intergenic
1035912596 8:3584009-3584031 GAGGTGTTTTTATAGTGGATGGG - Intronic
1036956132 8:13190362-13190384 CATGGGTGGTGACAGTGGAAAGG - Intronic
1039181421 8:34871108-34871130 CAGTGGGTATTACAGCGGAAAGG - Intergenic
1039537646 8:38332706-38332728 TAGGTGTTTTTTCAGGGGAAGGG + Intronic
1041441687 8:57903918-57903940 CAGGGGTTTTTATCTGGGAAAGG + Intergenic
1041617041 8:59919331-59919353 CAGGGTCTTGTACAGAGGAAGGG + Intergenic
1043185890 8:77149229-77149251 CAGGGTTTTTTACAGTTTTAGGG - Intergenic
1046367985 8:113261042-113261064 CATGTGTCTTTACAGTGGAATGG + Intronic
1046940290 8:119924506-119924528 CAGGAGATTTTAGAGTGGCAAGG - Intronic
1048024203 8:130569649-130569671 AAGGAGTTTTTCCAATGGAAGGG - Intergenic
1048426854 8:134331080-134331102 CTGGGGGTTTCACAGTGGCATGG - Intergenic
1049513177 8:143039886-143039908 CAGGGAAGGTTACAGTGGAAGGG + Intronic
1054981008 9:71206064-71206086 CATGTGTCTTTACAGTAGAATGG + Intronic
1061375052 9:130219341-130219363 CATGGGCTTTTGCAGAGGAAAGG - Intronic
1192224471 X:69218669-69218691 CAGGGCTTTTCACAGAGGGATGG + Intergenic
1194007667 X:88516272-88516294 CAAGGGTTTTTTTAGGGGAAAGG + Intergenic
1194066245 X:89266194-89266216 CAGGGTTTTATTCAGTGAAAAGG + Intergenic
1196236288 X:113284647-113284669 CATGTGTCTTTACAGTAGAATGG - Intergenic
1197656061 X:129117207-129117229 CAGTGGTGCTTACAGAGGAAGGG + Intergenic
1197722220 X:129753060-129753082 CAGGGGTGTTTTCAGAGGACTGG - Intronic
1197730954 X:129809603-129809625 CAGGGTTTCTTAGGGTGGAAGGG + Intronic
1199713235 X:150487131-150487153 CAGAGGTTCTCAAAGTGGAAGGG - Intronic
1200720416 Y:6600313-6600335 CAGGGTTTTATTCAGTGAAAAGG + Intergenic
1200939062 Y:8763657-8763679 CAGCTGTTTTTACAGGGGGAGGG + Intergenic
1201249123 Y:12038469-12038491 AAGTGCTTTTTACAATGGAAAGG + Intergenic