ID: 1183054501

View in Genome Browser
Species Human (GRCh38)
Location 22:35295312-35295334
Sequence AATTGGGAATACAGAGAAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 450}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183054497_1183054501 9 Left 1183054497 22:35295280-35295302 CCCTTTCTCAGCTCAGAGCAGTT 0: 1
1: 0
2: 4
3: 24
4: 277
Right 1183054501 22:35295312-35295334 AATTGGGAATACAGAGAAACAGG 0: 1
1: 0
2: 5
3: 30
4: 450
1183054498_1183054501 8 Left 1183054498 22:35295281-35295303 CCTTTCTCAGCTCAGAGCAGTTT 0: 1
1: 0
2: 1
3: 48
4: 4054
Right 1183054501 22:35295312-35295334 AATTGGGAATACAGAGAAACAGG 0: 1
1: 0
2: 5
3: 30
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183054501 Original CRISPR AATTGGGAATACAGAGAAAC AGG Exonic
901437618 1:9257634-9257656 AGTGGGGAAGAAAGAGAAACAGG + Intronic
902539526 1:17143987-17144009 GATTCGGAAAAGAGAGAAACTGG + Intergenic
905380320 1:37557195-37557217 AATTGGGAAGTCAGAGAAGGAGG + Intronic
906646747 1:47480662-47480684 AATTGGGAAAACTTGGAAACAGG - Intergenic
906959660 1:50411296-50411318 AACTGTAAAGACAGAGAAACAGG + Intergenic
907604550 1:55803741-55803763 AATTGGAAACACAGGGAAAAGGG - Intergenic
907994624 1:59617218-59617240 AAGTGAGAAAACAGAGAAAAAGG + Intronic
908156910 1:61362928-61362950 AATTGATAATGCAGATAAACAGG + Intronic
908611787 1:65869002-65869024 TATAGGGAATACAGATAATCTGG + Intronic
908712178 1:67028396-67028418 AATTGATAAAACAGTGAAACTGG - Intronic
909469188 1:76007515-76007537 AATAGTGAATCCAGATAAACTGG + Intergenic
910493300 1:87796859-87796881 TATGGGGAACAAAGAGAAACTGG + Intergenic
911360592 1:96871560-96871582 AATTGAGAAGACAAAGCAACTGG - Intergenic
911997010 1:104778159-104778181 AATTGGCAAAACATATAAACTGG + Intergenic
912588046 1:110784705-110784727 TAGTGGGAATTGAGAGAAACAGG - Intergenic
913041368 1:115028095-115028117 AATTTTGAAAACAGGGAAACTGG - Intergenic
913591015 1:120325417-120325439 AATTGGGAATACAAAGATGAAGG - Intergenic
913652355 1:120929686-120929708 AATTGGGAATACAAAGATGAAGG + Intergenic
914168753 1:145199385-145199407 AATTGGGAATACAAAGATGAAGG - Intergenic
914427828 1:147594885-147594907 AATTGGGAATAAAAAGAAAGGGG + Intronic
914523874 1:148443344-148443366 AATTGGGAATACAAAGATGAAGG - Intergenic
914599801 1:149192525-149192547 AATTGGGAATACAAAGATGAAGG + Intergenic
914642531 1:149623796-149623818 AATTGGGAATACAAAGATGAAGG + Intergenic
915194722 1:154181032-154181054 AAAGGGGAAGACAGAGGAACTGG - Intronic
915402244 1:155631868-155631890 AACTTGGAAAACAGAAAAACCGG - Intergenic
916009854 1:160694797-160694819 AACTTGGAAAACAGAAAAACTGG + Intronic
916529523 1:165642938-165642960 CATTGAGAAGACAGAGGAACAGG - Intronic
916994110 1:170277197-170277219 AAATGAGAATACATAGAAAGAGG - Intergenic
917049501 1:170903771-170903793 AATTGGTAAAACACAGAAACTGG - Intergenic
917144229 1:171870900-171870922 ATTTGAGAAGACAGAGAAAAAGG + Intronic
917499921 1:175576832-175576854 AATTGGGAGCACAGAGGAAGAGG - Intronic
917506516 1:175632280-175632302 CCTTGGGAACAGAGAGAAACTGG - Intronic
917835090 1:178935223-178935245 AATTGGGAATAAACTGAAACAGG + Intergenic
918967192 1:191366560-191366582 AATTGGGAATATATTGAACCAGG - Intergenic
919589967 1:199489510-199489532 AACTGGGAATTCTGAGAAAACGG + Intergenic
919604082 1:199659162-199659184 AAAGAAGAATACAGAGAAACTGG - Intergenic
919615582 1:199804618-199804640 ATTTGAAAATAAAGAGAAACTGG - Intergenic
921361849 1:214337318-214337340 AAATGGGAAGAAAGAGAAAAAGG + Intergenic
921607324 1:217171117-217171139 AAACTGGAATACATAGAAACAGG - Intergenic
921634375 1:217475644-217475666 AATTAGGAGCACAGAGAAAATGG + Intronic
921845156 1:219871253-219871275 TATTCGGGATACAGGGAAACAGG + Intronic
922793729 1:228326406-228326428 AAGTGAGGATACAGAGAAACTGG + Intronic
923855693 1:237843286-237843308 ACTTGGGAATACAGCTAACCAGG + Intergenic
1064551111 10:16501842-16501864 AATTCTGAAGACTGAGAAACTGG - Intronic
1066119737 10:32274112-32274134 AATTGGCAAAAAAGAGAAAAAGG - Intronic
1066162840 10:32752632-32752654 AATTGGGAAAAGATAGAAATAGG + Intronic
1066299444 10:34083947-34083969 AAATGTTATTACAGAGAAACAGG - Intergenic
1068840842 10:61612165-61612187 AGTTGAGAAGACAGAGAAATTGG + Intergenic
1071097318 10:81992692-81992714 AAATGGGAAGACAGAAAAAGAGG - Intronic
1071116010 10:82221247-82221269 AATTGGCAAGACAGAGAAAGAGG + Intronic
1071326498 10:84523866-84523888 TATTGGGAATACTCAGAAGCGGG - Intergenic
1072790243 10:98312515-98312537 AAGTGGGAAGAGGGAGAAACAGG - Intergenic
1072947644 10:99824953-99824975 AACTTGGAAAACAGAAAAACCGG - Intronic
1073050163 10:100661989-100662011 AACAGGGAGTACAGAGAACCAGG + Intergenic
1073233245 10:101990615-101990637 AAAGGGGAATAGAGAAAAACTGG + Intronic
1073276980 10:102320495-102320517 AATTGAGAAAACAGAAAAAATGG - Intronic
1073524390 10:104165847-104165869 ATTTGGGTATACCGAGAAAACGG + Intronic
1074369328 10:112886895-112886917 CTTTGGGAAGACAGAGAAAGGGG - Intergenic
1075895833 10:125993937-125993959 AACTGGGAAAACAGTGAGACAGG - Intronic
1076277586 10:129216821-129216843 GATTGAGAATACAGGGACACAGG + Intergenic
1076422823 10:130343525-130343547 AGTGGGGAAGACAAAGAAACAGG - Intergenic
1077361337 11:2141442-2141464 AATTGGGAACATAGAGAAAGAGG + Intronic
1077733500 11:4762727-4762749 AAGTGGAAAAACAGAGAAAAAGG + Intronic
1077923309 11:6656652-6656674 AATTTGGGATAAAGAGAAAGTGG - Intergenic
1079877397 11:25877032-25877054 TATTGTAAATTCAGAGAAACAGG - Intergenic
1080103706 11:28489467-28489489 AATGGGGAACACACATAAACAGG + Intergenic
1080310933 11:30891075-30891097 ACTTGGGAATGTAGAGAAATGGG - Intronic
1080331465 11:31144533-31144555 ACTAGTGAATACAGGGAAACTGG - Intronic
1081561680 11:44223136-44223158 CAATGAGAATACAGAAAAACTGG + Intronic
1083097387 11:60265736-60265758 AATAGGAAAAACAGAAAAACTGG - Intergenic
1083394260 11:62378824-62378846 AACTTGGAAAACAGAAAAACCGG - Intronic
1084750720 11:71202955-71202977 AATTTGGAAAACAGAGAAAAAGG - Intronic
1085137049 11:74100648-74100670 TATTTGGAAGACAGAGAGACAGG + Exonic
1085376992 11:76072953-76072975 AAATGTCAATACAGTGAAACAGG - Intronic
1085599524 11:77842599-77842621 ACTTGGGATTGGAGAGAAACAGG + Exonic
1085920088 11:80943608-80943630 AATGAGGAATACAGACAAAGAGG - Intergenic
1086496926 11:87413713-87413735 AGTTAGGAATACAGATAACCAGG + Intergenic
1086892431 11:92273156-92273178 ATTTGGGAAAACATAAAAACTGG - Intergenic
1087420046 11:97911132-97911154 AATTGGTAATAGAAAGAAAATGG + Intergenic
1087546329 11:99588489-99588511 AATTAGGAATTCTGGGAAACTGG + Intronic
1087724188 11:101699018-101699040 AACTTGGAAAACAGAAAAACCGG + Intronic
1088585461 11:111356812-111356834 AAATGGGAATACCAAGAAAAGGG - Intronic
1089471654 11:118726202-118726224 AACTTGGAAAACAGAAAAACCGG - Intergenic
1089633662 11:119798754-119798776 CAGTGGGAATCCAGAGACACAGG - Intergenic
1090625252 11:128602775-128602797 AATTTGGAATCAAAAGAAACAGG + Intergenic
1091143054 11:133252674-133252696 AACTGGGAGCACAGAGAAATAGG - Intronic
1091260888 11:134233299-134233321 AATTGGGAACACAGAGCAGGCGG - Intronic
1091893945 12:4085012-4085034 AATTGGAGATCCAGAGAAGCAGG + Intergenic
1093133958 12:15427166-15427188 AACAGGGAATAAAGAGAAAAAGG - Intronic
1093653206 12:21667610-21667632 AATAGGGATTACAGTGTAACGGG + Intronic
1093850285 12:24027982-24028004 GATGAGGAATACAGAGTAACAGG - Intergenic
1093922025 12:24869428-24869450 TATTGGGAAAAAAGGGAAACAGG - Intronic
1093942592 12:25070773-25070795 TAATGAGGATACAGAGAAACCGG - Intronic
1094226276 12:28049645-28049667 GATTGGGAAAAAAGGGAAACTGG - Intergenic
1094268602 12:28586640-28586662 AATTGAGAATAAACAGAGACAGG - Intergenic
1094752345 12:33426015-33426037 AGTTGGGAGAAAAGAGAAACAGG - Intronic
1094874441 12:34625467-34625489 AACTTGGAAAACAGAAAAACCGG - Intergenic
1095172390 12:39051131-39051153 ACCTGTGAATACTGAGAAACAGG + Intergenic
1095861047 12:46918348-46918370 AATTGGGAATACACAAACATTGG + Intergenic
1097171921 12:57119996-57120018 TAGTGGGAATACAGAGCAACTGG - Intronic
1097330993 12:58332938-58332960 AACTTGGAAAACAGAAAAACTGG - Intergenic
1097443663 12:59642904-59642926 AATTGGGAATACAGGCACAAAGG + Intronic
1097512919 12:60565711-60565733 AATTGGGAAGTCAGAAAGACTGG - Intergenic
1099006174 12:77237004-77237026 AAGTGAGAATATAGAGAAGCTGG - Intergenic
1099007480 12:77251149-77251171 AATTGAAAATGCAGATAAACTGG + Intergenic
1099265698 12:80444378-80444400 TATTGGGACTTCAGAGACACAGG + Intronic
1100558149 12:95718507-95718529 TATTTACAATACAGAGAAACAGG - Intronic
1101074695 12:101116702-101116724 AATTCGAAATACAGACAAGCTGG - Exonic
1103263706 12:119611310-119611332 TATTGAGGATATAGAGAAACTGG - Intronic
1103799290 12:123526861-123526883 AATTGGAAACAGAGAGGAACAGG - Intronic
1107026881 13:35810648-35810670 GATTGGGAAAACAGAGAAAATGG + Intronic
1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG + Intergenic
1109082694 13:57926010-57926032 AAAAGGGAATAAAGAGACACAGG + Intergenic
1110096946 13:71537771-71537793 AATTGGAAATACAGACAACAAGG - Intronic
1110685562 13:78369306-78369328 AATTGGGAATAAAGAACAATTGG - Intergenic
1111151531 13:84260273-84260295 TATTGGGAATTCAGGGAAAGGGG - Intergenic
1111644956 13:91021040-91021062 AATTGTCAATACACAGAAAAAGG + Intergenic
1111764070 13:92504544-92504566 AATTGCGAATAAAGACAAAATGG + Intronic
1112136964 13:96590320-96590342 AGGTGAGAATACAGAGAAAAGGG - Intronic
1112177737 13:97044216-97044238 AACTGGGAATAGAGAGCAAAAGG - Intergenic
1112515382 13:100048806-100048828 TATTAGAAATAAAGAGAAACGGG - Intergenic
1112833570 13:103484583-103484605 AATTGGAAATCAAGAAAAACTGG - Intergenic
1112950174 13:104985204-104985226 AATTTATAATACAGAGAATCAGG + Intergenic
1113005466 13:105696911-105696933 ACATGGGAATAAAGAGAAATGGG - Intergenic
1113177646 13:107583869-107583891 AATGAGGAAAAGAGAGAAACAGG - Intronic
1113684536 13:112273234-112273256 TATTGTCAATACAGGGAAACAGG + Intergenic
1114187168 14:20411547-20411569 TATTGGGAAGAAAGACAAACAGG - Intronic
1114307370 14:21436570-21436592 AATGGTGAAGACAGAGAAAATGG - Intronic
1114797912 14:25738093-25738115 ACTTAGGAATACAGATAACCAGG + Intergenic
1114990134 14:28276477-28276499 AATAAGGAATACAGACAATCAGG - Intergenic
1115157082 14:30353312-30353334 AATTGGGAATAGAAGGAATCAGG - Intergenic
1115518636 14:34210374-34210396 GATTGGGAATATAGAGCAACTGG - Intronic
1116521972 14:45860074-45860096 ACTTAGGAATACAGCTAAACAGG - Intergenic
1116726671 14:48569874-48569896 AAAAGGGACTACAGAGAACCTGG + Intergenic
1116769856 14:49114607-49114629 CTTTTGGAACACAGAGAAACAGG - Intergenic
1117220140 14:53595888-53595910 AATTGAGAAATCAGAAAAACAGG + Intergenic
1117670368 14:58100093-58100115 AAAAGGGAAGGCAGAGAAACAGG + Intronic
1117974618 14:61285029-61285051 ACTTTGGAATACTGAAAAACTGG - Intronic
1117980782 14:61340269-61340291 CATTGGAAAAACACAGAAACAGG - Intronic
1118253090 14:64182083-64182105 AAATGGTAGTACAGAGAAATGGG + Intronic
1118267179 14:64305908-64305930 AAATGGGACTACAGAAAAATAGG + Intronic
1118991862 14:70804129-70804151 AATTGGGAACATACAGAATCAGG - Intronic
1119758882 14:77137684-77137706 CAGTGGGAACACAGAGATACAGG - Intronic
1119904754 14:78291553-78291575 AATTTGGAAAAGAGAGAAAAGGG - Intronic
1120222636 14:81751755-81751777 AATTTGGAAAATTGAGAAACTGG - Intergenic
1120366214 14:83573796-83573818 AATTGGGATGAGAGAGAAAAGGG + Intergenic
1120591912 14:86385663-86385685 AATTGGGCAAACAGACAAATGGG + Intergenic
1121529827 14:94644440-94644462 AGTTGGGAACACAGAAAAAAAGG - Intergenic
1121745425 14:96286248-96286270 CATTGGGAAGACAGAAATACGGG + Intronic
1122185889 14:99995644-99995666 AATAAGGTATACAAAGAAACAGG - Intronic
1123218355 14:106832936-106832958 GCTTGGGAAGAGAGAGAAACTGG + Intergenic
1124206970 15:27729364-27729386 AATTGGAAATAGGGAGAGACTGG - Intergenic
1125188355 15:36959362-36959384 AATAGGGAAGACAGACAAACAGG - Intronic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1127557742 15:60104737-60104759 AATGGGGAAGACAGAGAACTTGG - Intergenic
1131518442 15:93095208-93095230 AGTTGGGAATGCAGAGTCACAGG + Intergenic
1132169832 15:99638784-99638806 AATTGAGAACAAAGAGAAAAAGG - Intronic
1133861873 16:9603548-9603570 AATTGTGAAGACAGATAAACAGG - Intergenic
1133880748 16:9779421-9779443 AATGGGGAATACAGATCAAATGG - Intronic
1136650876 16:31669195-31669217 ACCTAGGAATACAGTGAAACAGG - Intergenic
1136717424 16:32293341-32293363 ATTTGTGAGTACAGAGAGACTGG + Intergenic
1136835798 16:33499604-33499626 ATTTGTGAGTACAGAGAGACTGG + Intergenic
1137026813 16:35485537-35485559 AATTAGGCATATAGAGAAATGGG + Intergenic
1138560818 16:57800064-57800086 TATTGGGGAGACAGAGAGACAGG + Intronic
1138707026 16:58925998-58926020 GATTTGGGATTCAGAGAAACTGG - Intergenic
1138933064 16:61685124-61685146 AATTGAGAATAGAGAGAAGTTGG + Intronic
1203009005 16_KI270728v1_random:224433-224455 ATTTGTGAGTACAGAGAGACTGG - Intergenic
1203145977 16_KI270728v1_random:1799939-1799961 ATTTGTGAGTACAGAGAGACTGG + Intergenic
1143076405 17:4347948-4347970 AATTGGGAGTCCTGAGAATCAGG - Intronic
1143396782 17:6605592-6605614 AATTTTGAAAACTGAGAAACAGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144296349 17:13878646-13878668 TATTGGAAATAGAGAGATACAGG + Intergenic
1144442536 17:15296705-15296727 AATTGGGCAAACAGAGGAAGAGG - Intergenic
1146737973 17:35255827-35255849 AATTAGGGAGACAGAGAAATAGG - Intronic
1147490491 17:40861524-40861546 AATAGGGAATCCAAAGAAAATGG + Exonic
1148126386 17:45239421-45239443 AATGGGGAACCCAGAGATACAGG + Intronic
1148127341 17:45243613-45243635 AACTGGGAATCCAGAGAAACTGG - Intronic
1148127346 17:45243637-45243659 AGGTAGGAATCCAGAGAAACTGG - Intronic
1149058580 17:52393920-52393942 AATAGGAAAAACAGGGAAACAGG - Intergenic
1149127991 17:53258668-53258690 ACTTGGGAATACAGCTAACCAGG + Intergenic
1149779359 17:59384777-59384799 AATTAGAAATACAGGGAGACAGG - Intronic
1150275130 17:63892403-63892425 AACAGGGAAAACAGAGAAAAAGG - Intergenic
1150937858 17:69657006-69657028 TATTAGGAATAGAGAGAAATAGG - Intergenic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1154474247 18:14739206-14739228 ATTTGTGAGTACAGAGAGACTGG + Intronic
1155595424 18:27480579-27480601 ATTTGGGAATGGAGGGAAACCGG + Intergenic
1156811020 18:41251615-41251637 ACTTCAGAAGACAGAGAAACAGG - Intergenic
1156826956 18:41442238-41442260 AATTGATAATAGAGAAAAACAGG - Intergenic
1157031282 18:43911519-43911541 AGTTGGGAAGACAGAGTATCTGG - Intergenic
1157350623 18:46881800-46881822 AATTAAGAATACACAGACACCGG + Intronic
1157731477 18:50008059-50008081 TAATGGTAATACAGAGATACAGG - Intronic
1157854198 18:51089938-51089960 TAGTGGGGATACAGAGAAAATGG + Intergenic
1158859097 18:61574695-61574717 GCTTGGGAATACACAGAAATAGG - Intergenic
1160075046 18:75666762-75666784 TATTGGGAACACAGGGAAAATGG + Intergenic
1160783404 19:888685-888707 AACAGGAAATACAGACAAACGGG + Intronic
1161527886 19:4768809-4768831 AATTGGGAATGGGAAGAAACAGG + Intergenic
1161737218 19:5998759-5998781 ATTTGGGAACCCAGAGATACCGG - Intronic
1163184281 19:15626899-15626921 ATGTGGGAACAGAGAGAAACAGG - Intronic
1163740411 19:19008393-19008415 AATGGAGACTGCAGAGAAACTGG - Exonic
1163897876 19:20075495-20075517 AATTGGGAATAAAGAGGTATGGG - Intergenic
1163920154 19:20280630-20280652 AACTTGGAAAACAGAAAAACTGG + Intergenic
1166401757 19:42486606-42486628 ATTTGGCAATAAAAAGAAACGGG - Intergenic
1167229197 19:48271186-48271208 AATGGGGACAAGAGAGAAACTGG + Intronic
925236762 2:2285592-2285614 AATTGGGAAGACCCAGAAAGGGG - Intronic
925461378 2:4066181-4066203 AAGTAGGAAAAAAGAGAAACTGG - Intergenic
926246684 2:11126729-11126751 AATTGAGAATCCAGAGAACTGGG - Intergenic
926484201 2:13434420-13434442 AATGGGGAAGAGAGAGAAAGAGG - Intergenic
926618646 2:15025682-15025704 ACCTGGGAATACAGATAATCAGG - Intergenic
927002012 2:18806139-18806161 AATTGGAATTACAGAAAAAAAGG + Intergenic
927226964 2:20776630-20776652 AATTGGGAAGAGAGAGAATCTGG + Intronic
927505629 2:23612027-23612049 AATTGGGATTCCAGAAAAAGAGG + Intronic
928734835 2:34276102-34276124 ATGTGGGAATAAAGAGAAAGAGG + Intergenic
930170305 2:48245064-48245086 GATTTGGAAAACAGAGAGACAGG + Intergenic
930415767 2:51089415-51089437 AAATGGGAAAACAGAGGCACAGG + Intergenic
930777262 2:55185689-55185711 AATTGGGAAGAGAGATAAAGAGG - Intronic
930885314 2:56319248-56319270 AAATGGGAAAACTGAGACACAGG + Intronic
931172614 2:59820188-59820210 AATGGGAAATACATAGAAATAGG - Intergenic
932957102 2:76365306-76365328 AGTCAGGAATACAGAGAAAAAGG - Intergenic
933231000 2:79806989-79807011 ATTTGGGAATAAAGAGAAACAGG - Intronic
933479896 2:82842908-82842930 AAGTGTGAATAAAAAGAAACAGG + Intergenic
935577795 2:104728964-104728986 AATAGGGAATAGAGATAAATGGG + Intergenic
935724478 2:106011073-106011095 TATTGGGAAAAAAGGGAAACAGG - Intergenic
936876901 2:117200994-117201016 AATTAGGAAAAAAGAGAAAAAGG - Intergenic
937308944 2:120889820-120889842 TAATGAGAATGCAGAGAAACAGG + Intronic
937901607 2:127023940-127023962 TATTGGGAAGAAAAAGAAACAGG + Intergenic
938688284 2:133762448-133762470 CCTTGAGAATACAGAGCAACAGG + Intergenic
938956922 2:136307480-136307502 ATTTGGGAATACAGAGGGCCTGG + Intergenic
939488502 2:142847698-142847720 AATGGGGAAAAGAGAGAAGCTGG + Intergenic
939555704 2:143670267-143670289 CACTAGAAATACAGAGAAACAGG - Intronic
940842114 2:158595858-158595880 AATGGGAAATACAGAGTGACAGG + Intronic
941452675 2:165678402-165678424 AGTAGGGAATACAGAAAAAAGGG + Intronic
942464956 2:176198021-176198043 AATTAGGATTAAAGAGATACTGG + Intergenic
942875232 2:180787553-180787575 TGATGAGAATACAGAGAAACTGG + Intergenic
943015580 2:182506248-182506270 CATAGGGAACAAAGAGAAACAGG - Intronic
943228598 2:185213906-185213928 ACTTGATAATACAGAGCAACTGG - Intergenic
943368470 2:186986243-186986265 AAATGAGAATACATGGAAACAGG - Intergenic
943403087 2:187441182-187441204 AATTGCGAACACAGTGAATCTGG + Intronic
944664453 2:201948231-201948253 AATTGGCAAGACAGATCAACAGG - Intergenic
944986174 2:205180098-205180120 ACTTTGGAAGAAAGAGAAACAGG - Intronic
945004061 2:205384333-205384355 AAATGGAAAGACAGAGAAAAAGG + Intronic
945820458 2:214658365-214658387 ACTTAGGAATACAGATAACCAGG - Intergenic
945958158 2:216105534-216105556 AATTGGGAATAAAGGGGGACAGG - Intergenic
945969539 2:216222300-216222322 TATTGGGGATACAGAAAAAGAGG + Intergenic
946189579 2:218001334-218001356 AATGAGGATTGCAGAGAAACAGG - Intronic
947507213 2:230717134-230717156 AATTTGGATAACAGAAAAACTGG + Intronic
947538080 2:230953483-230953505 AGCTGGAAAGACAGAGAAACAGG + Intronic
947572313 2:231245846-231245868 AAATGTGAATGCAGAGACACTGG + Intronic
947662628 2:231881140-231881162 AATTGGTCATTCAGAGAAACTGG + Intergenic
947875696 2:233467052-233467074 AATGAGGAATACTGAGAATCAGG - Intronic
948362322 2:237431609-237431631 TAATGAGAATACAGAGAAACTGG + Intergenic
1168927537 20:1595222-1595244 AAGTGGAAATCCAGAGGAACAGG + Intronic
1169161873 20:3386959-3386981 AACTGAGAATTCAGAGAAACTGG + Intronic
1169549467 20:6687487-6687509 AATGAGGAATAGTGAGAAACTGG + Intergenic
1169694254 20:8369623-8369645 AATTTGCAATACAGAGTGACTGG - Intronic
1169818545 20:9684158-9684180 AACTGTGACTACAGAGATACTGG + Intronic
1170256887 20:14354781-14354803 ACCTGGGAATACACAGAAACTGG - Intronic
1170778362 20:19400980-19401002 AATTGAGAAAATAGAGGAACTGG - Intronic
1172325271 20:34029580-34029602 AATGGGGAAGAGAGAGAAAGAGG + Intronic
1173141409 20:40487990-40488012 CCTTGGGAAACCAGAGAAACAGG + Intergenic
1173261049 20:41436372-41436394 GATGGAGAATACAGAGAAAGCGG + Intronic
1173473766 20:43343931-43343953 AATTGAGAATAAGGAGACACCGG + Intergenic
1173496875 20:43525833-43525855 AATTGGGGGTACAGAGATGCCGG - Intronic
1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG + Intronic
1177681220 21:24374140-24374162 AATTTTGTATACAGGGAAACTGG - Intergenic
1177726276 21:24972094-24972116 AATTAGGAATGCAAAGAAATGGG + Intergenic
1180672446 22:17563828-17563850 AATACAGAATACAGAAAAACTGG + Intronic
1180838196 22:18942629-18942651 AACTTGGAAAACAGAAAAACCGG + Intergenic
1183054501 22:35295312-35295334 AATTGGGAATACAGAGAAACAGG + Exonic
1184182479 22:42839731-42839753 AAGTGAGGGTACAGAGAAACTGG - Intronic
1184507972 22:44915694-44915716 AATGGGGAACAGAGAGAAAGAGG + Intronic
1185262999 22:49880712-49880734 ATATGGGAATACAAAGAATCAGG - Intronic
949508006 3:4744832-4744854 AAATGGGAATTCAGGGAAACAGG + Intronic
950232998 3:11293050-11293072 ACTAGGAAATACAGAGAAAGGGG + Intronic
951510654 3:23498315-23498337 TATTTGAAAAACAGAGAAACTGG - Intronic
952611818 3:35219336-35219358 AATAAGGCATACAAAGAAACAGG - Intergenic
952734698 3:36677336-36677358 AATTAGGAATAAAGTGAAACAGG - Intergenic
955993188 3:64650496-64650518 AAATGGGAAAAAAGAGAAAAGGG + Intronic
956232513 3:67032740-67032762 AATGGGAAACACAGAAAAACTGG - Intergenic
956309076 3:67859200-67859222 AATTGGAAATACAGGCACACAGG + Intergenic
956312615 3:67898025-67898047 AAGTGAGAAAAAAGAGAAACAGG - Intergenic
956548308 3:70432177-70432199 TGTTGAGAATATAGAGAAACTGG - Intergenic
956692475 3:71890891-71890913 AAATGGGAATACAGAGAAAAGGG + Intergenic
957323780 3:78665856-78665878 TACTGGAAATATAGAGAAACAGG - Intronic
957348626 3:78994563-78994585 AATTGGAAATACCGAGTAAATGG + Intronic
957598650 3:82302792-82302814 AATTGGGCATAAAGCAAAACAGG - Intergenic
957825036 3:85430588-85430610 AATTGCGAATAAGGAGAAAGGGG + Intronic
958180804 3:90058021-90058043 AATAGGGAAGACAGATAAACTGG - Intergenic
958804021 3:98787725-98787747 AAGTGGGAACACAGAGCCACAGG - Intronic
958935032 3:100247582-100247604 AACTGGGACTACAGACTAACTGG + Intergenic
959547740 3:107616516-107616538 TGTTGAGGATACAGAGAAACTGG - Intronic
959549672 3:107640431-107640453 AGTTGGGAATACAGACAGACAGG - Intronic
960027877 3:113029467-113029489 AACTTGGAAAACAGAAAAACCGG - Intergenic
961125542 3:124414410-124414432 AATTGAGGAGACTGAGAAACAGG - Intronic
961157848 3:124695966-124695988 AACTGGGGATGTAGAGAAACAGG + Intronic
961956633 3:130810874-130810896 AATTGGGAAGAGGGAGAAGCTGG + Intergenic
961995381 3:131236605-131236627 AATTCGGAATTCAGTGAAAGAGG + Intronic
963695747 3:148564599-148564621 AACTTGGAAAACAGAAAAACCGG - Intergenic
965154959 3:165039532-165039554 AATTGTAAATAAAGAGGAACTGG - Intronic
965720684 3:171658178-171658200 ATTGGCAAATACAGAGAAACTGG + Intronic
967026309 3:185567750-185567772 AACTTGGAAAACAGAAAAACCGG - Intergenic
967134271 3:186499924-186499946 ATCTGGGAATACAGATAACCAGG - Intergenic
967542126 3:190680098-190680120 AATAGGGAAGGCAAAGAAACAGG + Intergenic
967873825 3:194252832-194252854 AACTGGGAATGGAGAGAAACCGG + Intergenic
968240520 3:197079123-197079145 GATTGAAAATACAGAGAAACTGG - Intronic
969994916 4:11302109-11302131 AAATGGTATTACAGAGAGACAGG - Intergenic
970306662 4:14739642-14739664 AAGTAGGAAAAGAGAGAAACAGG - Intergenic
970378263 4:15480405-15480427 AATTTGGAGGAAAGAGAAACAGG - Intronic
970901955 4:21169816-21169838 GATTGTGAATACAGAAAATCAGG - Intronic
971433239 4:26590979-26591001 AATTGTGAATACATAAATACAGG - Intronic
971545691 4:27882200-27882222 AGTTGGGAAAACAGGGAAACTGG - Intergenic
971662168 4:29433136-29433158 ATTCAGAAATACAGAGAAACTGG + Intergenic
972521464 4:39861155-39861177 AAGGGGGAATAAAGAGAGACTGG + Intronic
972968706 4:44545433-44545455 AATTAGTACTACAGAGAATCAGG - Intergenic
973099003 4:46238665-46238687 AATTGGTATTACAGAAAAATAGG + Intergenic
973128171 4:46614913-46614935 AATAGGGAATCCAGAGAAGAAGG - Intergenic
973563247 4:52157925-52157947 AAACTGGAATTCAGAGAAACTGG + Intergenic
973754956 4:54065084-54065106 AATTGGGAAAAAAGAGACTCTGG - Intronic
973827831 4:54726586-54726608 AAGTGGGAAGACAAAGAAACTGG + Intronic
973992129 4:56419812-56419834 AATTTGGAATAGACAGAGACTGG + Intronic
974313600 4:60246860-60246882 CATTGCGAATACAGATAAAGAGG + Intergenic
974572102 4:63666206-63666228 AATTAGGAATACAGGTAACCAGG - Intergenic
975072504 4:70159150-70159172 ATGTGGGATTACAGAGGAACAGG - Intronic
975772650 4:77744767-77744789 AACTGGGAATACAGGAAAAAGGG - Exonic
975775979 4:77787540-77787562 AATTGTGTATGCTGAGAAACTGG - Intronic
975923593 4:79422294-79422316 AATGGGGATTAAGGAGAAACAGG - Intergenic
976028433 4:80720716-80720738 TGTTGGGAATACAGAGAAACAGG + Intronic
976518735 4:86002353-86002375 AATTGGAAAGAGAGAGAAAAGGG - Exonic
977208974 4:94195763-94195785 AATTTGGAATGCAGAAAGACTGG - Intergenic
977334392 4:95677813-95677835 AGTTAGTAATACTGAGAAACTGG + Intergenic
977629497 4:99225949-99225971 TAGTGAGGATACAGAGAAACAGG - Intergenic
978984597 4:114996057-114996079 AACTGGGAAATCAGAGAACCTGG - Intronic
979830290 4:125292184-125292206 AATTGAGACTACAAAGCAACTGG - Intergenic
980224238 4:129960483-129960505 ACTTGGGAATACAGCTAACCAGG - Intergenic
980578057 4:134711294-134711316 ACCTGAGAATACAGAGATACAGG - Intergenic
980654714 4:135766864-135766886 AATTGGTACCACAGAGAAAGGGG - Intergenic
981186291 4:141807782-141807804 AAGTGGGCATACAGGGAAATGGG - Intergenic
981682676 4:147418208-147418230 AATTTGTAATACAGAGGAATGGG - Intergenic
982446790 4:155500532-155500554 AATTGTAAATGCAGAGACACTGG + Intergenic
982915320 4:161202042-161202064 AATTGGGAAAATATAGAAAAAGG - Intergenic
984600027 4:181715406-181715428 AACTGGGAATTCTGAGATACAGG + Intergenic
985388598 4:189470715-189470737 CAATGGGAATACATAGACACAGG - Intergenic
986205340 5:5619930-5619952 AAATGGGAATCCAGAGCTACGGG + Intergenic
986876719 5:12120081-12120103 AACTGGGAAGACAAAGAAATAGG - Intergenic
987947897 5:24637188-24637210 ACTTGGGAAGACAGGGAAAGAGG - Intronic
988232599 5:28500160-28500182 AACAGGGAATAAAGAGAGACAGG - Intergenic
988290379 5:29276622-29276644 AATTGGAAAGACAAAGTAACTGG - Intergenic
988380457 5:30492135-30492157 AACTTGGAAAACAGAAAAACCGG - Intergenic
989192302 5:38683151-38683173 AATTGGTAATAATGAGAAAAGGG + Intergenic
989984626 5:50683452-50683474 AATTGGGAATACAAAGATGAAGG + Intronic
990437948 5:55812931-55812953 AAGTGAGATTACAGAGAAATGGG + Intronic
990816293 5:59789261-59789283 AATGTGCAATACAGAGAAGCAGG + Intronic
990998664 5:61759455-61759477 ACTTTGTAATAAAGAGAAACAGG - Intergenic
991080131 5:62589558-62589580 ACATGGGAATAAAGAGAAAGGGG - Intronic
991177016 5:63700736-63700758 ACCTAGGAATACAGATAAACAGG + Intergenic
991653701 5:68882218-68882240 AATGTGGAAAACAAAGAAACAGG - Intergenic
992574225 5:78095109-78095131 AATGGGAAAAACAGATAAACTGG - Intronic
993074530 5:83211940-83211962 AATTGGACATACAGAGAAACAGG + Intronic
995142904 5:108753452-108753474 AATCAGGAATCCAGACAAACTGG - Intronic
996064979 5:119070274-119070296 TCTTTGGAATACAGAGGAACAGG - Intronic
996456459 5:123689167-123689189 AACAGAGAATACAGAGAAACTGG + Intergenic
997408909 5:133675262-133675284 AAATGGGAACACAGAGTAACTGG + Intergenic
999103792 5:149050742-149050764 AATTGGGAAAAGAAAGAACCTGG + Intronic
999952153 5:156662908-156662930 AACTTGGAAAACAGAAAAACCGG - Intronic
1000141504 5:158408708-158408730 AAGTGGGAAAAAAGAGAAAAAGG - Intergenic
1003391966 6:5722215-5722237 AAGTGGCAATACAGCGAAAAGGG + Intronic
1004721080 6:18267734-18267756 GAGTGGGAATACAGAGAGACAGG + Intergenic
1004773468 6:18813934-18813956 AATTAGGAATATAGATAATCAGG + Intergenic
1005175398 6:23039130-23039152 AATTGAGAATAAAGAGAGATAGG + Intergenic
1005529980 6:26693597-26693619 AATTGTGAAAAGAGAGAAAGGGG + Intergenic
1005540816 6:26808050-26808072 AATTGTGAAAAGAGAGAAAGGGG - Intergenic
1005729879 6:28686452-28686474 AACTTGGAAAACAGAAAAACCGG + Intergenic
1007097544 6:39223087-39223109 AATTGGTATTACAAAGAATCAGG - Intronic
1007762086 6:44139132-44139154 AATGAGGAATGCAGAGAAAAGGG - Intronic
1008779794 6:55089759-55089781 AGTTTGTGATACAGAGAAACAGG - Intergenic
1009011628 6:57850140-57850162 AATTGTGAAAAGAGAGAAAGGGG - Intergenic
1009296678 6:61959125-61959147 GATTGTGAAGGCAGAGAAACTGG - Intronic
1010591931 6:77722397-77722419 AACTTGGAAAACAGAAAAACCGG - Intronic
1010620858 6:78072379-78072401 AATTGGGAATTCAAATAAAAAGG - Intergenic
1010726997 6:79346448-79346470 AATTGTAAAGACAGGGAAACTGG - Intergenic
1010730137 6:79382317-79382339 CATTGGGCATAGAGAAAAACTGG + Intergenic
1011122364 6:83967426-83967448 AATGGAAAATACAGAGAGACTGG - Intergenic
1011122664 6:83971084-83971106 AATGGAAAATACAGAGAGACTGG - Intergenic
1011332021 6:86219199-86219221 AAAGGGGAATGAAGAGAAACTGG - Intergenic
1012646190 6:101684987-101685009 AATTGAGAAGACACAGAAGCAGG - Intronic
1012846116 6:104391494-104391516 AATAAGGAATACACAGAAAGAGG + Intergenic
1013714001 6:112935928-112935950 ACCTGGGAATATAGAGATACAGG - Intergenic
1014184496 6:118419800-118419822 AATTGGAAATAGAGAGGAAGGGG - Intergenic
1014730007 6:125021711-125021733 AACTGGGAAAACAGAAAAATGGG - Intronic
1015287161 6:131499286-131499308 AATAGGGTGTACAGAGAAAGGGG - Intergenic
1016494890 6:144649884-144649906 ACTGGAGAATACAGAGAGACTGG + Intronic
1016654787 6:146506097-146506119 AATAGGAAAAACAGAGCAACTGG + Intergenic
1016809854 6:148249777-148249799 AATGAGGAAAACAGACAAACAGG + Intergenic
1018163265 6:161068822-161068844 AAATGGGAAAACACAGAAACAGG + Intronic
1020602771 7:10296658-10296680 AATTGAGAATAGACAGAAAGCGG - Intergenic
1020733565 7:11915958-11915980 AACTGGGAATTCTGAGAAAGAGG + Intergenic
1023567274 7:41536066-41536088 TAGTGGGAATACAGTGAACCAGG + Intergenic
1023621558 7:42078249-42078271 AATTTGGAAAATAGAGAAATGGG - Intronic
1024272181 7:47650889-47650911 AGTTGAGAATACAGAGATTCAGG - Intergenic
1024436888 7:49366954-49366976 AATTTGGAACACAGAGGTACAGG - Intergenic
1024804241 7:53118042-53118064 AATTGGGAATAAACAAAAAAAGG - Intergenic
1024894261 7:54239148-54239170 AATTGGAGAGACAAAGAAACTGG + Intergenic
1027747965 7:82102122-82102144 AATCGGGACTAAAGAGAAAAAGG + Intronic
1028062115 7:86333889-86333911 TAATGTGGATACAGAGAAACTGG + Intergenic
1028613236 7:92735436-92735458 AATTGGGACTTCATAGACACTGG - Intronic
1028801897 7:94975935-94975957 AAAGAGGAAGACAGAGAAACCGG - Intronic
1029966899 7:104749811-104749833 AACTTGGAAAACAGAAAAACTGG - Intronic
1030371464 7:108704275-108704297 ACTTAGGAATACAGATAACCAGG + Intergenic
1030580120 7:111344455-111344477 AATGGGTAATAGAGAAAAACAGG - Intronic
1032173602 7:129606293-129606315 AATGGGGGATAAAGAGAGACAGG + Intergenic
1032223687 7:130013182-130013204 AATTAGGAAGAGAGGGAAACAGG - Intergenic
1033956463 7:146855009-146855031 AATTGAGAAAATATAGAAACAGG + Intronic
1035902351 8:3471143-3471165 TATTGAGAATACAAAGAATCTGG - Intronic
1036010904 8:4721964-4721986 AAAACGGAATACAAAGAAACAGG + Intronic
1036091813 8:5673891-5673913 AATGCGGAAGACATAGAAACAGG + Intergenic
1036292153 8:7503369-7503391 AACTTGGAAAACAGAAAAACTGG - Intronic
1036533304 8:9618724-9618746 ATTTGGAAATTGAGAGAAACAGG + Intronic
1037333128 8:17764252-17764274 CCTTGGGGATACAGAGAATCAGG + Intronic
1037381778 8:18292832-18292854 CCTTGGGAATACAGAGAAATTGG + Intergenic
1038028990 8:23620358-23620380 AATTGGCAATACATAGAGATGGG + Intergenic
1039415991 8:37394408-37394430 AATTTTGAAAGCAGAGAAACTGG - Intergenic
1039545841 8:38410666-38410688 ATTTGGCATTACAGAAAAACTGG - Intergenic
1039556207 8:38477060-38477082 AATTGTGAATGCAGAGGAAAAGG + Intergenic
1039925735 8:41930349-41930371 AATAGTATATACAGAGAAACTGG + Exonic
1040886558 8:52269669-52269691 AATTGGCAGTGCAGAGAAAAGGG - Intronic
1041094503 8:54335596-54335618 TATTGTGCATACACAGAAACAGG + Intergenic
1041984523 8:63906067-63906089 AATTGGGAATTGATAGTAACAGG - Intergenic
1042090424 8:65153474-65153496 AATTGGGAATCCAGACAATGGGG + Intergenic
1042467676 8:69146720-69146742 AATTGGGAACACATGGCAACTGG - Intergenic
1042574711 8:70205258-70205280 TAATGGGAATAGACAGAAACAGG + Intronic
1043215984 8:77588863-77588885 GATTGGGAATAGAGAGAGAGAGG + Intergenic
1044330652 8:90916384-90916406 AAGTGGGAAAACTGAGAACCAGG + Intronic
1044337807 8:91008260-91008282 ATTTAGGAATAGAGAGAAATAGG + Intronic
1044791020 8:95847055-95847077 TAATGGGAAGACAGTGAAACGGG - Intergenic
1045275822 8:100704396-100704418 AAAGGGGAAAACAGATAAACTGG + Intronic
1045420385 8:102008860-102008882 GCTTGGGAATTCAGATAAACAGG - Intronic
1045818505 8:106306581-106306603 ACTTAGCAATACAGAGAAAATGG + Intronic
1046604558 8:116356541-116356563 TATTGGGCATACAGAGACATAGG + Intergenic
1047061704 8:121234534-121234556 AGGTGGGGATACATAGAAACAGG - Intergenic
1048360426 8:133692863-133692885 AGTTGGCAAGACTGAGAAACTGG + Intergenic
1048391977 8:133975328-133975350 ATTTGGGCAAACAGAGTAACTGG - Intergenic
1050544086 9:6694885-6694907 AATTGGAAATACATAAAAATAGG - Intergenic
1050930655 9:11320176-11320198 TATTGTGACTACAGAGAAAAGGG + Intergenic
1051219409 9:14832464-14832486 AATAGGGAAGGCAAAGAAACAGG + Intronic
1052593224 9:30525958-30525980 CATTGATAATACAGAAAAACAGG + Intergenic
1052645065 9:31224387-31224409 ATTTGGAAATACAAAGAAAAGGG + Intergenic
1055303417 9:74904975-74904997 GAGTGGGTATACAGAGAAAGTGG - Intergenic
1056139080 9:83657021-83657043 AGTTTGGAAGAGAGAGAAACGGG - Intergenic
1057242533 9:93423947-93423969 AAATGGGAATACATACAACCTGG + Intergenic
1057701877 9:97369257-97369279 ATTTGGAGATACAGAGAAAGAGG + Intronic
1057736648 9:97668480-97668502 AATGGGCCATACAGAAAAACTGG - Intronic
1058497144 9:105571155-105571177 GATTGTGGATACAGAGAAAGTGG + Intronic
1059232851 9:112737476-112737498 TAGTGAGAATACTGAGAAACAGG - Intergenic
1059869924 9:118561620-118561642 AACTGGAAATTCAGAGAATCGGG + Intergenic
1060429345 9:123535931-123535953 AATTGGGAAAACAGAAAAGGGGG + Intronic
1060951862 9:127609027-127609049 AATTAAGAATACAGAGCAAAGGG + Intergenic
1061835521 9:133326586-133326608 AATTAGGAAAACAGATAAAAAGG - Intergenic
1185761459 X:2692074-2692096 AATTCGGAAAACAGAAAAAGTGG + Intronic
1186753908 X:12649899-12649921 AATTGGGAGAAGAGATAAACAGG - Intronic
1187719042 X:22132602-22132624 AACTGTTAACACAGAGAAACGGG - Intronic
1188162245 X:26818596-26818618 AATTGGTACTACAGAGAATGGGG + Intergenic
1188462010 X:30438893-30438915 ACTGGGGAATACAGATGAACTGG + Intergenic
1189475411 X:41350385-41350407 AGTTTGAAATACAGTGAAACAGG + Intronic
1189706607 X:43765034-43765056 CATTGGGAAAACAAAGAAAAGGG + Intergenic
1189878354 X:45461470-45461492 AATCGAGAATACAAAGCAACCGG - Intergenic
1190385936 X:49882141-49882163 AATCACGAATACAAAGAAACTGG - Exonic
1190446828 X:50534104-50534126 CATTTGGAATAAAGAGTAACAGG + Intergenic
1190810342 X:53877218-53877240 ACCTGGGAATACAGCTAAACAGG - Intergenic
1190907263 X:54739261-54739283 ACTTGGGACTACACAGAAATGGG - Intergenic
1191949611 X:66574174-66574196 AATTGGCATTCCAGAAAAACAGG - Intergenic
1192295669 X:69845324-69845346 AATTGGGAAATCAGTGAAATTGG + Intronic
1193340308 X:80341182-80341204 AAGTGGGATTACTGAGACACAGG + Intronic
1193571494 X:83150424-83150446 AAGTAGAAATACAGAGACACAGG - Intergenic
1194209573 X:91055105-91055127 AATGGGGAATCCCAAGAAACTGG + Intergenic
1194558357 X:95389824-95389846 AAATGGGTATACAGAGAGAGAGG - Intergenic
1194806422 X:98334080-98334102 AATTGGAATTACTGAGTAACAGG - Intergenic
1194909796 X:99627998-99628020 AACTAGGAATACAGCTAAACAGG + Intergenic
1197621412 X:128754223-128754245 AATTGGGAATTCAAAGAATGAGG + Intergenic
1198050707 X:132950935-132950957 AATTGTGAATTCAGATTAACTGG + Intronic
1198070800 X:133146798-133146820 TATAGGGCACACAGAGAAACAGG - Intergenic
1198280434 X:135136415-135136437 AATCAGGAATAAATAGAAACTGG - Intergenic
1198290525 X:135236099-135236121 AATCAGGAATAAATAGAAACTGG + Intergenic
1199470134 X:148186007-148186029 GAATGGGAATACAGAAAATCAGG + Intergenic
1200327258 X:155254192-155254214 AATTAGGAATAAACAGAAAATGG + Intergenic
1200793199 Y:7317565-7317587 AAATGCAAATACAGAGAAAGAGG - Intergenic
1201490292 Y:14533792-14533814 CAATGGGAATACAGGGACACAGG - Intronic
1201982262 Y:19920612-19920634 AAGTGGGATTACAGAGAGAAAGG - Intergenic