ID: 1183058693

View in Genome Browser
Species Human (GRCh38)
Location 22:35322325-35322347
Sequence CAGTAAACCCAGGCCTCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183058688_1183058693 12 Left 1183058688 22:35322290-35322312 CCTGGGCCAAAGGACCTGTGGGT 0: 1
1: 0
2: 0
3: 14
4: 194
Right 1183058693 22:35322325-35322347 CAGTAAACCCAGGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1183058684_1183058693 28 Left 1183058684 22:35322274-35322296 CCACTGGCAGGGAGAGCCTGGGC 0: 1
1: 0
2: 2
3: 53
4: 510
Right 1183058693 22:35322325-35322347 CAGTAAACCCAGGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1183058689_1183058693 6 Left 1183058689 22:35322296-35322318 CCAAAGGACCTGTGGGTGACATT 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1183058693 22:35322325-35322347 CAGTAAACCCAGGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1183058690_1183058693 -2 Left 1183058690 22:35322304-35322326 CCTGTGGGTGACATTGAAGCTCA 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1183058693 22:35322325-35322347 CAGTAAACCCAGGCCTCCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183058693 Original CRISPR CAGTAAACCCAGGCCTCCGC GGG Intronic
900308861 1:2023966-2023988 CTGGAAACCCTGGCCTCCCCTGG + Intronic
902309671 1:15572305-15572327 CTGTAATCCCAGGCCTAGGCGGG - Intronic
902519977 1:17010813-17010835 CAGGAAGCCAAGGCTTCCGCAGG - Intronic
909921033 1:81380024-81380046 CAGTAAAACCTGGCCTTCTCTGG + Intronic
912930053 1:113949996-113950018 CAGTCGACCCAGGCCTCTTCGGG - Intronic
917701861 1:177589823-177589845 CAGCAAATGCAGGCCTCTGCAGG - Intergenic
917702285 1:177593658-177593680 CAGACAACCCAGGCATCCACAGG + Intergenic
923181731 1:231526722-231526744 CATTTACCCCAGGCCTCCCCAGG - Intergenic
923207233 1:231771006-231771028 CAGGACACCCTGGCCTCAGCCGG + Exonic
924775967 1:247114644-247114666 CAGCAAGCCCAGGCCTCAACAGG + Intergenic
1067384890 10:45809918-45809940 CATTAAATCCAGGCCTCAGATGG - Intergenic
1069557135 10:69405910-69405932 CAGTAAAGCCAGGACTCCATGGG - Intronic
1075262306 10:120973807-120973829 CAGTAACCTCAGGTCTCCCCAGG + Intergenic
1075880127 10:125843874-125843896 CAGGGAACCCAGACATCCGCTGG + Intronic
1077356832 11:2122645-2122667 CAGCCAGCCCAGGCCTCAGCCGG - Intergenic
1084888031 11:72223473-72223495 CAGCAAACTCGCGCCTCCGCGGG - Intergenic
1086110306 11:83192068-83192090 CTCTTAACCCAGGCCTCCGGAGG - Intergenic
1089152250 11:116373178-116373200 CTGAAAACCCTGGCCTCCCCTGG + Intergenic
1090373463 11:126272966-126272988 CAGTATTCACAGGCCTCCACTGG + Exonic
1091237293 11:134030904-134030926 CATTAAACACACGCCTCAGCCGG - Intergenic
1096216046 12:49797822-49797844 AGGCAAACCCAGGCCTCCTCAGG + Intronic
1100871100 12:98911341-98911363 CAGTACACCCAAACCTCCTCAGG - Intronic
1101573695 12:105978636-105978658 CAGCAACCCCAGGCCTGAGCTGG - Intergenic
1106212507 13:27663323-27663345 CAGTAAACCAAGATCTCCTCAGG + Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1108174465 13:47777973-47777995 CAGTAATCTCAGGGCTCCACTGG + Intergenic
1108563823 13:51674500-51674522 CAGTACACCCAGGCCTGGACTGG - Intronic
1108621598 13:52190289-52190311 CAGCACCCCCAGGCCTCCCCTGG - Intergenic
1108665088 13:52621589-52621611 CAGCACCCCCAGGCCTCCCCTGG + Intergenic
1114378258 14:22172900-22172922 AAGCAAACCCAAGCCTCTGCAGG + Intergenic
1115349979 14:32383635-32383657 CAATAAGCCCAGGCCTGCTCTGG + Intronic
1128542034 15:68542997-68543019 CAGTAAACCAAGGCATCCCGAGG - Intergenic
1138558514 16:57786689-57786711 CAGGAAACCCAGCCCTCGGCAGG + Intronic
1139354597 16:66360079-66360101 CAGGAAGCCCTGGCTTCCGCTGG + Intergenic
1139613478 16:68075188-68075210 CAGTAATCCCAGGGCTGGGCAGG + Intronic
1140486383 16:75296842-75296864 CAGTAAACCAAGGCCGTCACAGG - Intronic
1141887868 16:86905114-86905136 CAGCAAACCCAGGCCTAGACAGG + Intergenic
1146555891 17:33823697-33823719 CAGTAATCCCAGACCTCTTCTGG + Intronic
1147871762 17:43592460-43592482 CAGATACCCCAGGCCTCCCCTGG - Intergenic
1148812131 17:50300083-50300105 CAGTGTTCCCAGGCCTCCCCAGG - Intergenic
1152737454 17:82004424-82004446 CTGCAAACCCAGGCCCCCGGTGG - Intronic
927313002 2:21651437-21651459 CAGCCATCCCAGGCCTCTGCTGG + Intergenic
929441180 2:41966842-41966864 CAGTTACCCCAGGGCTCCTCAGG - Intergenic
929781525 2:44960372-44960394 CTGCAAACCCAGGCCTACCCTGG + Intergenic
932575887 2:72962147-72962169 TAGTCATCCCAGGCCTCCCCAGG - Intronic
940984579 2:160039858-160039880 CACTGAACCCAGGCTTCCACTGG + Intronic
948889789 2:240901970-240901992 CAGTAGCCCCAAGCCTCCTCTGG + Intergenic
1172615138 20:36278346-36278368 CAGTAGACTCAGACCTCCCCAGG - Intergenic
1180054661 21:45351655-45351677 CAGCAAGGCCAGGCCTCTGCTGG - Intergenic
1183058693 22:35322325-35322347 CAGTAAACCCAGGCCTCCGCGGG + Intronic
1184386068 22:44175408-44175430 CAGGAATCCCCGGCCACCGCAGG + Intronic
950359557 3:12440896-12440918 CAGAGAACACAGGCCTCCGAGGG - Intergenic
953744176 3:45560570-45560592 CAGCAATCCCTGGCCTTCGCGGG + Intronic
965622737 3:170656884-170656906 CCTGAAACCCAGGCCTCCCCTGG - Intronic
966941779 3:184752498-184752520 GAGAAAACCCAGGCCCCCGAGGG - Intergenic
969513578 4:7633516-7633538 AGGTAAACACAGGGCTCCGCTGG - Intronic
969585047 4:8086844-8086866 CAGTCAATCCAGGCCCCAGCTGG + Intronic
974229447 4:59091490-59091512 CAGTAAGCCCCTGCCACCGCAGG + Intergenic
979900612 4:126212189-126212211 CAGTACACCCGGACCTCAGCTGG - Intergenic
987308480 5:16660577-16660599 CAGAAAACACAGGGCTCGGCCGG + Intergenic
997562582 5:134861237-134861259 CTGTAATCCCAGGCCTTCGGGGG - Intergenic
998433141 5:142083885-142083907 CAGGAAACCCAGGCCTTGGTGGG - Intergenic
1010025048 6:71205153-71205175 AAGTCTACCCAGGCCTCTGCTGG - Intergenic
1017135443 6:151143471-151143493 CAGCAAAGCCAGGACTCTGCTGG + Intergenic
1023988467 7:45112301-45112323 CTGTAATCCCAGGCCTCGGTGGG + Intergenic
1026666374 7:72343298-72343320 CTGTAATCCCAGGCCGACGCGGG + Intronic
1031972539 7:128074932-128074954 CAGTGATCCCAGGCCTGCTCAGG + Intronic
1031980030 7:128118877-128118899 CTGGATACCCAGGCCTCTGCTGG + Intergenic
1032466318 7:132147858-132147880 CAGGACACCCAGGCCTCCCTAGG + Intronic
1038491873 8:27977302-27977324 CAGAAAACCCAGGACTCCCCAGG + Intronic
1041689755 8:60678218-60678240 CAGTCACCCCCGGCCGCCGCCGG + Intergenic
1044779585 8:95730406-95730428 CGGTAAACCCAGGCTTCTGCAGG - Intergenic
1045382776 8:101643729-101643751 CAGGCCACCCAGGCCTCAGCTGG + Intronic
1049417875 8:142503798-142503820 CTGGAAACCCAGCCCTCCCCAGG - Intronic
1053188371 9:36037605-36037627 CAGTAAACCCTGTCCCCCGGGGG + Intronic
1054741475 9:68810384-68810406 CATGAAACCCAGGCCTTCGGAGG + Intronic
1056594780 9:87998050-87998072 ATGTAAACCCAGGCTTCAGCAGG - Intergenic
1057551452 9:96053820-96053842 CAGGAACCCCAGGCCACAGCAGG + Intergenic
1060170037 9:121453752-121453774 GTGAAAACCCAGGCCTCCACTGG - Intergenic
1196714996 X:118802216-118802238 CAGAGAATCCAGGCCTCCTCTGG - Intergenic