ID: 1183058860

View in Genome Browser
Species Human (GRCh38)
Location 22:35323174-35323196
Sequence GCCCTGTCCTGGCACTCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 11, 3: 35, 4: 387}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183058860_1183058868 26 Left 1183058860 22:35323174-35323196 CCAGGTGAGTGCCAGGACAGGGC 0: 1
1: 0
2: 11
3: 35
4: 387
Right 1183058868 22:35323223-35323245 TGCAGGAGCTTCCTGCCCAGTGG 0: 1
1: 0
2: 4
3: 52
4: 362
1183058860_1183058865 -9 Left 1183058860 22:35323174-35323196 CCAGGTGAGTGCCAGGACAGGGC 0: 1
1: 0
2: 11
3: 35
4: 387
Right 1183058865 22:35323188-35323210 GGACAGGGCAGGGCACGGCCAGG 0: 1
1: 0
2: 83
3: 469
4: 1303
1183058860_1183058867 9 Left 1183058860 22:35323174-35323196 CCAGGTGAGTGCCAGGACAGGGC 0: 1
1: 0
2: 11
3: 35
4: 387
Right 1183058867 22:35323206-35323228 CCAGGAAGAGCTGTCAGTGCAGG 0: 1
1: 0
2: 1
3: 35
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183058860 Original CRISPR GCCCTGTCCTGGCACTCACC TGG (reversed) Exonic
900120200 1:1045609-1045631 GCCCTGGCCTGACCCACACCTGG + Intronic
901012798 1:6210725-6210747 GCCCTCTTCTGGGACTCACCCGG - Intronic
901032732 1:6317593-6317615 GCCCTGCCCTGACCCTCAGCAGG + Intronic
901242557 1:7704044-7704066 GCCCCGCCCTGGCCCTCCCCGGG + Intronic
901794018 1:11670233-11670255 GCGCTGCCCAGGCAATCACCAGG - Intronic
902780537 1:18702000-18702022 GCCCTGTCCCAGCACACACCAGG + Intronic
903952833 1:27006041-27006063 GCCCTGGCCTGGCGCCCTCCAGG - Exonic
904456895 1:30653318-30653340 GACCTGTCCTGACACTCAACTGG - Intergenic
904792852 1:33036717-33036739 GCCCAGTCCTGCCGCTCACCTGG + Exonic
904841330 1:33373704-33373726 GCCCTGCACTGGCCTTCACCAGG + Intronic
904915934 1:33970677-33970699 GCCCTGTCCCTGCACGCACCTGG - Intronic
905414697 1:37795745-37795767 GTCCTGTCCTGGTACCCACCTGG + Exonic
905454039 1:38075448-38075470 GCCCTGGCCTGGGCCACACCTGG + Intergenic
905511183 1:38521752-38521774 GCCCTGTCATGGCCCACACAGGG + Intergenic
905648011 1:39638048-39638070 GCCCTTTCCTGGCCCTTAACAGG + Intronic
906933529 1:50192038-50192060 GCCCTGTCCAGACAGTCACATGG + Intronic
907412095 1:54290185-54290207 GCCCAGTCCTTCCATTCACCAGG + Intronic
909286848 1:73830326-73830348 GCCCTCTCTTGGCATTTACCAGG - Intergenic
911157442 1:94651479-94651501 GCCCAGTCCTGGCATCCACTGGG + Intergenic
912923914 1:113896284-113896306 AGCATGTCCTGGCACTCAGCAGG + Exonic
913957506 1:143318836-143318858 GCCCTGCCCTGGCACTGCCTTGG - Intergenic
913958305 1:143321999-143322021 GCCCTGCCCTGACACTGTCCTGG - Intergenic
913958365 1:143322206-143322228 GCCCTGTCATGGCCCTGCCCTGG - Intergenic
914051820 1:144144200-144144222 GCCCTGCCCTGGCACTGCCTTGG - Intergenic
914052620 1:144147374-144147396 GCCCTGCCCTGACACTGTCCTGG - Intergenic
914052680 1:144147581-144147603 GCCCTGTCATGGCCCTGCCCTGG - Intergenic
914126517 1:144818960-144818982 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
914126577 1:144819167-144819189 GCCCTGCCCTGACACTGTCCTGG + Intergenic
914127377 1:144822341-144822363 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
915611163 1:156994219-156994241 GCACTGTGCTGGAACTCAGCTGG - Intronic
915666372 1:157448917-157448939 GACCTGGCCTGCCACACACCTGG + Intergenic
920340593 1:205272936-205272958 GACCTCTCCTGGTACTCAGCAGG - Exonic
920597066 1:207282676-207282698 GCCCTGTCCACGCCCACACCTGG - Intergenic
924554980 1:245110603-245110625 GCCCTGCTCTGGCCCTCAGCGGG - Intronic
1063145306 10:3290493-3290515 GCCATGTGCTGGCCCTCACCTGG + Intergenic
1063385077 10:5611318-5611340 GCCCAGGCCTGGCACACAGCAGG + Intergenic
1065127187 10:22584941-22584963 GAGCTGCCCTGTCACTCACCGGG + Intronic
1066194061 10:33081562-33081584 CCCCTGTCCTGGTCCACACCTGG - Intergenic
1066577029 10:36837255-36837277 GCTCCTGCCTGGCACTCACCTGG + Intergenic
1066759202 10:38737990-38738012 GCCCTGTCCCAGTACTGACCCGG + Intergenic
1066759302 10:38738361-38738383 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
1066759361 10:38738568-38738590 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1066759711 10:38739746-38739768 TCCCTGTCCTGGCCCTAGCCTGG + Intergenic
1066961454 10:42231032-42231054 GCCCTGTCCTGGCAGTGCCTTGG - Intergenic
1066961914 10:42233022-42233044 TCCCTGTCCTGGCCCTAGCCTGG - Intergenic
1066962268 10:42234211-42234233 GCCCTGCCCTGACACTGTCCTGG - Intergenic
1066962327 10:42234418-42234440 GCCCTGTCATGGCCCTGCCCTGG - Intergenic
1066962422 10:42234780-42234802 GCCCTGTCCCAGTACTGACCCGG - Intergenic
1067344600 10:45428199-45428221 CCCCTGTCCTGGCTCTGACTGGG + Intronic
1073260799 10:102188788-102188810 GCCCTGAGCTTGCACACACCTGG + Intergenic
1073486756 10:103824091-103824113 TGCCTGACCTGGCACTCCCCTGG + Intronic
1073566486 10:104539861-104539883 GCCAGGGCCAGGCACTCACCTGG - Intergenic
1076476748 10:130758893-130758915 ACCCTTCCCTGTCACTCACCTGG - Intergenic
1076770396 10:132659719-132659741 AACCTTGCCTGGCACTCACCAGG + Intronic
1076828068 10:132980396-132980418 GCACTCACCGGGCACTCACCGGG - Intergenic
1076828071 10:132980407-132980429 GCACTCACCAGGCACTCACCGGG - Intergenic
1076872800 10:133201895-133201917 GCCAAGGCCTGGGACTCACCGGG - Exonic
1076889782 10:133277749-133277771 GCCCTGCCCTGCCTCTCCCCAGG - Intergenic
1077034944 11:490023-490045 GCTCCGTCCTGGCGCTCACCTGG + Exonic
1077056710 11:597486-597508 GCCGTGTCCTGGCTATCGCCCGG - Exonic
1077057499 11:601999-602021 GCACTGGCCTGGCTCACACCTGG - Intronic
1077464052 11:2725124-2725146 ACCCTGCCCTGGCTCTCCCCTGG - Intronic
1079314092 11:19392934-19392956 TCCCTGCTCTGGCACTCACTGGG - Intronic
1080750173 11:35143723-35143745 GCCCTGGCCTGTCTCTCCCCAGG + Intronic
1080801517 11:35614601-35614623 ACCCAGTCCTGCCACTTACCAGG - Intergenic
1081705488 11:45180438-45180460 GCCCAGCCCTGGCACCCCCCGGG + Intronic
1081813715 11:45927331-45927353 GCCCTGTGCAGGCACTGGCCTGG + Exonic
1083328075 11:61883771-61883793 GCCCTGTCGAGGCACTGACAGGG + Intronic
1083610666 11:64002750-64002772 GCCCTGTCCTGGCTCTTACCTGG + Intronic
1083612993 11:64013275-64013297 GCCCCATGCTGGCACTCCCCCGG - Intronic
1084298331 11:68227554-68227576 GCGGTCTCCTGGCACTCCCCAGG - Intergenic
1084438609 11:69158029-69158051 GCCCTGTCCCGAGACTCAGCCGG + Intergenic
1084459389 11:69287724-69287746 GCCAGGTACTGGCACCCACCTGG + Intergenic
1084666847 11:70580943-70580965 GCCCTGACCTGGAGCCCACCAGG + Intronic
1084751884 11:71209452-71209474 TCCCTGTCCAGGGACACACCTGG + Intronic
1085386893 11:76162700-76162722 GCCCCTTCCTCACACTCACCAGG - Intergenic
1087006257 11:93475042-93475064 GCTCTGTCCTTGAACTGACCAGG + Intergenic
1088274166 11:108066714-108066736 GCTGTGTCCTGGCACACAGCTGG - Intronic
1088687096 11:112293723-112293745 GTCCTCTCATGGCACTCAGCTGG - Intergenic
1089070357 11:115695361-115695383 GCTCTGGCCTTGCATTCACCTGG - Intergenic
1089563399 11:119357168-119357190 GCCCTGCCCTGGCTCTCACCTGG + Exonic
1090283376 11:125477756-125477778 GCACTGGCCTGGCTCTCCCCTGG + Intronic
1090437550 11:126699069-126699091 GACCTGTCCTGCCTCTCTCCTGG - Intronic
1091741440 12:2962836-2962858 TCCCTGCTCTGCCACTCACCAGG - Intronic
1092216833 12:6689349-6689371 GCCCTCCCCTTGCACTCACCCGG + Exonic
1093765024 12:22952861-22952883 GCCCTGTGCATGCACACACCTGG + Intergenic
1093828690 12:23728058-23728080 GCCCTGTCCTTTCACTCAGAGGG - Intronic
1094620099 12:32072696-32072718 GCAATGTCCTTGCACTGACCAGG + Intergenic
1096235220 12:49921830-49921852 GCCCCTTCCTGGCACACACGAGG - Intergenic
1098022386 12:66169744-66169766 GCCATCTCCTGGGACTCACAGGG - Intronic
1098652452 12:72990333-72990355 GCCCTTCCCTGACAGTCACCAGG + Intergenic
1104990353 12:132620919-132620941 TCCCTGGCCTGGGACTGACCCGG + Intronic
1105889773 13:24674257-24674279 CCCCTGTGCTGGCTCCCACCAGG - Intergenic
1107381259 13:39858658-39858680 GACCTGTCCTGGCACAGACTAGG + Intergenic
1107434479 13:40370199-40370221 CCCCTCTTCTGTCACTCACCTGG - Intergenic
1113904444 13:113812779-113812801 GACCTGTCCTGTGACCCACCCGG - Exonic
1114558097 14:23573323-23573345 GCCCTGTCCTGAAACTGAGCTGG + Intronic
1116962673 14:50982399-50982421 GCACTGTTCTGCCAGTCACCAGG - Intronic
1118741528 14:68742800-68742822 GCCCTGACTTGGCACCCACTGGG - Intergenic
1119046127 14:71320538-71320560 GCCCAGACCTGGCCCTCCCCGGG - Intronic
1121208728 14:92190576-92190598 TCCCTGCCCTGCCACTCACCAGG - Intergenic
1121240589 14:92427300-92427322 GCCAGGTCCTGGCACAAACCTGG - Intronic
1121437772 14:93930260-93930282 CCCCGGGCCTGGCACACACCAGG + Intergenic
1121491302 14:94363364-94363386 GCCCTGGCCTGGCTCTCTCTGGG + Intergenic
1122881814 14:104693696-104693718 GAGCTGTCCTGGCCCTCGCCGGG + Intronic
1122956818 14:105075059-105075081 GCCCAGACCTGGCACCCAGCAGG - Intergenic
1123014712 14:105368171-105368193 GCCCTCTCCTGGCTCACACCGGG + Intronic
1123114270 14:105886787-105886809 CCCCTGACCTGGACCTCACCTGG - Intergenic
1123116428 14:105896202-105896224 CCCCTGACCTGGACCTCACCTGG - Intergenic
1123118444 14:105905307-105905329 AACCTGTCCTGGAACTCACCTGG - Intergenic
1202929738 14_KI270725v1_random:26836-26858 CCCCTGTTCTGGCCCTGACCTGG + Intergenic
1202930103 14_KI270725v1_random:28185-28207 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1202930878 14_KI270725v1_random:31254-31276 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
1123422258 15:20143254-20143276 GCCCTGTCATGGCCCTGCCCTGG - Intergenic
1123422356 15:20143627-20143649 GCCCTGTCCCAGTACTGACCTGG - Intergenic
1123442644 15:20302715-20302737 GCCCTGTCCCAGTACTGACCTGG + Intergenic
1123442742 15:20303087-20303109 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
1123443575 15:20306357-20306379 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
1123531486 15:21149794-21149816 GCCCTGTCATGGCCCTGCCCTGG - Intergenic
1123531584 15:21150167-21150189 GCCCTGTCCCAGTACTGACCTGG - Intergenic
1123966808 15:25467623-25467645 GCCCTGTTCTGGCACTTGCAGGG - Intergenic
1124099244 15:26678109-26678131 GCCCTATCCTAGCCCTCACATGG - Intronic
1124254626 15:28130810-28130832 GCCCTGTGCTGGGTCCCACCGGG - Intronic
1124355706 15:28993316-28993338 GTCCTGTCCTTGCCCTCTCCAGG - Intronic
1126197589 15:45949386-45949408 GTCCTATCCTGGCAATCACCTGG + Intergenic
1128215143 15:65929701-65929723 TCCCCACCCTGGCACTCACCGGG + Exonic
1128942864 15:71802628-71802650 GCCCTTTCTTTGCAGTCACCCGG - Intronic
1129410436 15:75347868-75347890 CCCCTGGCCTGGCACCCACAGGG - Intronic
1129511212 15:76124099-76124121 GCCCTGTCCTAGCTCTGCCCAGG + Intronic
1129658289 15:77539240-77539262 GCTCTCACCTGGCTCTCACCTGG - Intergenic
1129825316 15:78631030-78631052 GCCCTGGCCTGGCTGTCACCAGG + Intronic
1130042890 15:80419615-80419637 GCCCAGTCCTGGCATTGACATGG + Intronic
1132667758 16:1089874-1089896 GCCATCTCCGGGCACTCACGGGG - Intergenic
1132765082 16:1530484-1530506 GCCCTGTCCAGCCCCACACCTGG - Intronic
1132864030 16:2084902-2084924 GCCCTGGCCAGGCCCTCACCTGG + Intronic
1132892462 16:2210962-2210984 GGGCTGTCCTGGCTCTGACCTGG - Exonic
1134442126 16:14304602-14304624 GCTCTGTCCAGGCTCTGACCAGG + Intergenic
1136429298 16:30187562-30187584 TCCCTGCTCTGCCACTCACCTGG + Intronic
1136718452 16:32302420-32302442 GCCCTGCCCTGACACTATCCTGG - Intergenic
1136723423 16:32340595-32340617 GCCCTGCCCTGACACTGTCCTGG - Intergenic
1136723477 16:32340791-32340813 GCCCTGTCCTGGCCCTGGCCTGG - Intergenic
1136723481 16:32340802-32340824 GACCTGTCCTGGCCCTGTCCTGG - Intergenic
1136723489 16:32340824-32340846 GCCCTGTCATGGCCCTGCCCTGG - Intergenic
1136723587 16:32341197-32341219 GCCCTGTCCCAGTACTGACCCGG - Intergenic
1136773354 16:32859138-32859160 GCCCTGTCCCAGTACTGACCCGG + Intergenic
1136773449 16:32859511-32859533 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
1136836827 16:33508690-33508712 GCCCTGCCCTGACACTATCCTGG - Intergenic
1136841766 16:33546673-33546695 GCCCTGCCCTGACACTATCCTGG - Intergenic
1136841823 16:33546880-33546902 GCCCTGTCATGGCCCTGCCCTGG - Intergenic
1136841919 16:33547242-33547264 GCCCTGTCCCAGTACTGACCCGG - Intergenic
1136862397 16:33711722-33711744 GCCCTGTCCCAGTACTGACCTGG + Intergenic
1136862495 16:33712095-33712117 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
1136862551 16:33712302-33712324 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1136870626 16:33804333-33804355 GCCCTTTCCTGGCGCTCAGGTGG + Intergenic
1136897163 16:34002008-34002030 GCCCTGTCATGGCCCTGCCCTGG - Intergenic
1136897260 16:34002381-34002403 GCCCTGTCCCAGTACTGACCCGG - Intergenic
1138540119 16:57682751-57682773 TCCCTGTCCAGTGACTCACCAGG - Intronic
1138654228 16:58481627-58481649 CTCCTGTCCTGCCACCCACCCGG + Intronic
1138872485 16:60908247-60908269 TCCCTGTCCTGGTACTTCCCAGG - Intergenic
1139594533 16:67950149-67950171 CCCTGGGCCTGGCACTCACCTGG - Intronic
1140396065 16:74627798-74627820 GCCCTGTCCTGCCAAACACTAGG - Intronic
1140917840 16:79509590-79509612 GCCCTGTGCTGGCCCAGACCCGG - Intergenic
1142378786 16:89720682-89720704 GCCCCGTCCTCGCCCTCCCCGGG + Intronic
1203002844 16_KI270728v1_random:176568-176590 GCCCTGTCCCAGTACTGACCCGG + Intergenic
1203002943 16_KI270728v1_random:176941-176963 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
1203002951 16_KI270728v1_random:176963-176985 GACCTGTCCTGGCCCTGTCCTGG + Intergenic
1203002955 16_KI270728v1_random:176974-176996 GCCCTGTCCTGGCCCTGGCCTGG + Intergenic
1203003009 16_KI270728v1_random:177170-177192 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1203007976 16_KI270728v1_random:215345-215367 GCCCTGCCCTGACACTATCCTGG + Intergenic
1203075773 16_KI270728v1_random:1121248-1121270 GCCCTGTCCCAGTACTGACCCGG + Intergenic
1203075865 16_KI270728v1_random:1121621-1121643 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
1203101546 16_KI270728v1_random:1311725-1311747 GCCCTTTCCTGGCGCTCAGGTGG - Intergenic
1203123890 16_KI270728v1_random:1559905-1559927 GCCCTGTCCCAGTACTGACCTGG + Intergenic
1203124033 16_KI270728v1_random:1560462-1560484 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1203134450 16_KI270728v1_random:1712974-1712996 GCCCTGTCCCAGTACTGACCCGG + Intergenic
1203134548 16_KI270728v1_random:1713347-1713369 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
1203134556 16_KI270728v1_random:1713369-1713391 GACCTGTCCTGGCCCTGTCCTGG + Intergenic
1203134560 16_KI270728v1_random:1713380-1713402 GCCCTGTCCTGGCCCTGGCCTGG + Intergenic
1203134614 16_KI270728v1_random:1713576-1713598 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1203147003 16_KI270728v1_random:1808969-1808991 GCCCTGCCCTGACACTGTCCTGG - Intergenic
1203151931 16_KI270728v1_random:1846970-1846992 GCCCTGCCCTGACACTATCCTGG - Intergenic
1203151988 16_KI270728v1_random:1847177-1847199 GCCCTGTCATGGCCCTGCCCTGG - Intergenic
1203152084 16_KI270728v1_random:1847539-1847561 GCCCTGTCCCAGTACTGACCCGG - Intergenic
1143410152 17:6703859-6703881 GCCCTGGCCAGGGGCTCACCTGG + Exonic
1143472533 17:7184959-7184981 GCGCAGTGCTGGCACACACCAGG + Intergenic
1143822460 17:9575773-9575795 GCCCTCACCCGGGACTCACCAGG + Exonic
1144938735 17:18921485-18921507 GCCCTCTCCTGATGCTCACCTGG + Intronic
1145248229 17:21283771-21283793 GCCCCATCCTGGCTCTCTCCTGG - Intergenic
1145938302 17:28727492-28727514 CCCCTGTCCTGGCTCTCGCAAGG - Intronic
1146458892 17:33028223-33028245 ACCCTGCCCTGGCACTGACCTGG + Exonic
1146723847 17:35141960-35141982 GCCCTGGCCAGCCACTTACCTGG + Exonic
1146953682 17:36923472-36923494 TCCCTACTCTGGCACTCACCTGG + Intergenic
1147423101 17:40332224-40332246 GCCCTGGCCTGGCGCCCAGCTGG - Intronic
1148633901 17:49132708-49132730 GCCCCGCCCTGGCACCGACCCGG - Intronic
1148700422 17:49583435-49583457 GCAGAGACCTGGCACTCACCTGG + Intronic
1148860241 17:50600823-50600845 CCCCTGCCCTGTCACTTACCTGG - Exonic
1149515317 17:57276797-57276819 TCCGTTACCTGGCACTCACCAGG - Intronic
1150636988 17:66919906-66919928 GCCTTGTCCTGGTCCTCTCCTGG - Intergenic
1152225642 17:79091388-79091410 GTCCTTTCCTGGCACTGGCCTGG - Intronic
1152570417 17:81119129-81119151 ACCCTCACCTGGCCCTCACCTGG - Intronic
1152741949 17:82022355-82022377 GCCCAGTGCTGGCGCCCACCGGG + Intronic
1153033482 18:736469-736491 GCCCTGTACCGCCACTCACCAGG - Intronic
1153522723 18:5967638-5967660 GGCCTGACCTCGCACTCACTTGG - Intronic
1154112239 18:11579986-11580008 GCGCTCTCCTGTCACTAACCTGG - Intergenic
1154175774 18:12086752-12086774 GTCCTGTTCTGGCCCTGACCTGG + Intergenic
1154175853 18:12087023-12087045 GCCCTGTCCTGGCCCCGCCCAGG + Intergenic
1154415426 18:14173260-14173282 GCCTTGTCCTGGCACTGACCCGG - Intergenic
1154415660 18:14174077-14174099 GTCCTGTTCTGGCCCTGACCTGG - Intergenic
1157226296 18:45868079-45868101 GCCCTGTCCTGGCACACCTGAGG - Intronic
1158273527 18:55742181-55742203 GACCTGCCCTGGCCCTCCCCTGG + Intergenic
1158960768 18:62586015-62586037 GCCCTGCACTGGCATTCAGCAGG + Intronic
1160765485 19:805733-805755 GCCCTGTCCTACCACTGCCCTGG - Intronic
1161106024 19:2444540-2444562 ACCCTGTCCTGGGTCTCCCCAGG - Exonic
1161397715 19:4053238-4053260 GGCCTGTGCTGTCACCCACCGGG + Intronic
1162772458 19:12957276-12957298 GCCCTGCCCTGGCCCACACCGGG - Intergenic
1163411798 19:17159489-17159511 GCTCTGCCCAGGCACTCACAGGG + Intronic
1163713988 19:18863609-18863631 GTCCTGTGCAGGCGCTCACCGGG - Exonic
1163725415 19:18920682-18920704 GCCTCGTCCTGACACCCACCAGG + Exonic
1164401384 19:27904552-27904574 CCCCTGTGCTGGCCTTCACCAGG + Intergenic
1164552129 19:29220800-29220822 GCCCTGTGCTGGGCCTAACCTGG + Intergenic
1164804306 19:31104456-31104478 GCTCTGCCCGGGCACCCACCTGG - Intergenic
1165434814 19:35789999-35790021 GCCCCGTCCTGGCTCCTACCTGG + Intergenic
1165725593 19:38110442-38110464 GCCCTGTACTGGGACCCACTTGG - Intronic
1165871330 19:38975567-38975589 TACCTGTCCCGGCGCTCACCTGG + Exonic
1166780682 19:45340966-45340988 GCCCCGTCCTGGGGCTCTCCGGG + Intronic
1202691215 1_KI270712v1_random:96624-96646 GCCCTGCCCTGGCACTGCCTTGG - Intergenic
1202692017 1_KI270712v1_random:99798-99820 GCCCTGCCCTGACACTGTCCTGG - Intergenic
1202692077 1_KI270712v1_random:100005-100027 GCCCTGTCATGGCCCTGCCCTGG - Intergenic
926272095 2:11374577-11374599 GGCCTGTCCTGGCTCTCACAGGG - Intergenic
927189732 2:20509382-20509404 GCAGTGTCCTGGGCCTCACCAGG + Intergenic
927476691 2:23419348-23419370 GGTCTGTCCTGGCGCTCCCCAGG + Intronic
927872866 2:26634722-26634744 GCCCTGTCCTGGCCATTAACGGG - Intronic
928103616 2:28453552-28453574 TCCCTGTGCTGGGACCCACCTGG - Intergenic
928363487 2:30684263-30684285 GACCTGTCCTGTCATTCAGCTGG - Intergenic
929801901 2:45111605-45111627 GCTCTGTTCTGGCCCTCATCTGG - Intergenic
930033203 2:47070534-47070556 TCCCTGTCCTGCCCCTCCCCAGG - Intronic
931223672 2:60310668-60310690 GCCCTGGCCTGGAAATCACCTGG + Intergenic
932803195 2:74761108-74761130 GTCCTGTCCAGGCACTTCCCTGG - Intergenic
933726895 2:85432060-85432082 GCCCCTTCATGGCACTCCCCTGG + Intronic
933954321 2:87353967-87353989 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
933954380 2:87354174-87354196 GCCCTGCCCTGACACTGTCCTGG + Intergenic
933955174 2:87357326-87357348 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
934238518 2:90250187-90250209 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
934238576 2:90250394-90250416 GCCCTGCCCTGACACTGTCCTGG + Intergenic
934239365 2:90253541-90253563 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
934273821 2:91563158-91563180 GCCCTGCCCTGGCACTGCCTTGG - Intergenic
934274619 2:91566316-91566338 GCCCTGCCCTGACACTGTCCTGG - Intergenic
934322629 2:91982712-91982734 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
934460842 2:94213156-94213178 GCCCTGTCCCAGTACTGACCCGG + Intergenic
934460993 2:94213725-94213747 GCCCTGCCCTGACACTGTCCTGG + Intergenic
934461807 2:94216894-94216916 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
934765653 2:96878672-96878694 GCTCTGGGCTGGCACTCACTTGG + Intronic
935145154 2:100390505-100390527 GCCTTGTCCTGGCACTTCCCAGG + Intergenic
935818526 2:106870076-106870098 GCTCTGTACAGGCAGTCACCTGG + Intronic
937104742 2:119299968-119299990 TCCCCGTCCAGGCATTCACCAGG + Intergenic
940335782 2:152525780-152525802 GCCCTCTGCTGCCACTCAGCCGG + Intronic
946249152 2:218402402-218402424 GCCTCTTCCTGGCCCTCACCTGG - Exonic
947622073 2:231597281-231597303 GGCCTGGCCTGGCCCACACCCGG - Intergenic
948206577 2:236165879-236165901 GCCAGGGCCTGGCACCCACCTGG - Exonic
948395738 2:237643617-237643639 GCCCTGGCCAGGCTCTCCCCTGG - Intronic
1169225707 20:3855414-3855436 GCCCTGTCCTGGCACGGAGCTGG + Intronic
1170441610 20:16385291-16385313 GCTCTCTCCTGACACTCAGCAGG + Intronic
1170889791 20:20367843-20367865 GCCCGGTCCAGGCACACGCCCGG - Intergenic
1171355577 20:24543250-24543272 GCACTGTGCTGGCCCCCACCCGG - Exonic
1172018824 20:31898152-31898174 GCCCTCTCCTGGCAATCATCTGG - Intronic
1172671267 20:36635786-36635808 GCCCTGGCCTTGCACTCCCGGGG + Intronic
1173741583 20:45406073-45406095 CCCCTGCCCTGGGACTCGCCCGG - Intronic
1173748218 20:45454512-45454534 GAGCTGTCCTGACACTCAGCGGG - Intergenic
1175259223 20:57664214-57664236 GCCTGGTCCCGGGACTCACCTGG + Intronic
1175427516 20:58878067-58878089 GCCCTTTCCTGGCATGCAACAGG + Intronic
1175846886 20:62064432-62064454 GCCCCGTGCGGCCACTCACCTGG + Exonic
1175897868 20:62347331-62347353 GCCCTGTCCTAGGCCCCACCCGG - Intronic
1175906379 20:62381594-62381616 GCCCTGACCTGCCACTCACCCGG + Intergenic
1175913065 20:62413791-62413813 GCCCGGTCCTGGCTCAGACCCGG - Intronic
1176384827 21:6134096-6134118 GGCCTTTTCTGGCACTCAGCTGG + Intergenic
1176591760 21:8655435-8655457 CCCCTGTTCTGGCCCTGACCTGG + Intergenic
1176592898 21:8659877-8659899 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
1176857896 21:13986004-13986026 GCCTTGTCCTGGCACTGACCCGG + Intergenic
1176866695 21:14058191-14058213 GCCTCATCCTGGCACTGACCCGG - Intergenic
1176866931 21:14059000-14059022 GTCCTGTTCTGGCCCTGACCTGG - Intergenic
1176882775 21:14216783-14216805 GCCTTGTCCAGGGAATCACCTGG - Intronic
1178407409 21:32335922-32335944 GCCCTGTCCTGTGACTCCCTGGG + Intronic
1179738645 21:43404156-43404178 GGCCTTTTCTGGCACTCAGCTGG - Intergenic
1180274607 22:10632547-10632569 CCCCTGTTCTGGCCCTGACCTGG + Intergenic
1180274969 22:10633896-10633918 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1180275751 22:10637019-10637041 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
1180549285 22:16528243-16528265 GCCCTGTCCCAGTACTGACCCGG + Intergenic
1180549382 22:16528616-16528638 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
1180550204 22:16531862-16531884 ACCCTGCCGTGGCACTCTCCTGG + Intergenic
1180852411 22:19028240-19028262 GCTCTGTCCTGGGGCCCACCCGG + Intergenic
1180985413 22:19901256-19901278 CTCCTGTCCTGGCACCCACGGGG + Intronic
1181354441 22:22289860-22289882 GCCCTGCCCTGGCACTGCCTTGG - Intergenic
1181355252 22:22293013-22293035 GCCCTGCCCTGACACTGTCCTGG - Intergenic
1181589779 22:23876933-23876955 GCACTGTCCAGCCACTCAACTGG - Intronic
1181856177 22:25783180-25783202 GCCCTGACCAGGCCCTGACCAGG + Intronic
1182278761 22:29206245-29206267 GCCGTGTCCCTGCCCTCACCCGG - Intronic
1182298904 22:29327254-29327276 CCCCAGTCCTGGCACTGGCCTGG - Intergenic
1182777237 22:32840002-32840024 GCCCTGTCCTGGACCTCCCGGGG - Intronic
1183036543 22:35144838-35144860 GCCCTTCCCAGGCACCCACCTGG + Intergenic
1183058860 22:35323174-35323196 GCCCTGTCCTGGCACTCACCTGG - Exonic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1183591034 22:38779396-38779418 GCCTTTTCCTGCCACTCATCTGG - Exonic
1183645340 22:39123245-39123267 GCCCTGGCCTGGCCATCAACCGG + Intronic
1184099463 22:42334426-42334448 GCCCTGTCCTCCCCATCACCTGG + Intronic
1184233612 22:43171459-43171481 CGCCTGCCCTGGCACTCACAGGG + Intronic
1184402573 22:44282382-44282404 GCCCTGTCCTGGCAGTGCCTTGG + Intronic
1184709528 22:46240395-46240417 CACCTATCCTTGCACTCACCAGG - Exonic
1185331481 22:50253972-50253994 GCCCTGTCCTGGCTCTGCCTCGG - Intronic
1185343375 22:50301185-50301207 GCCCTGTCCCCACACGCACCAGG + Intronic
1185402418 22:50625879-50625901 CCCCTGTCCTGGCCTTCCCCTGG - Intronic
952795936 3:37239155-37239177 GCCCTGTACTAGCACTGACTGGG + Intergenic
953820771 3:46205799-46205821 GCCCTGGCCTGGCTCTTGCCAGG - Intronic
954424426 3:50435908-50435930 ATCCTGGCCTGGCACTCACTCGG - Intronic
957095249 3:75771952-75771974 GCCCTGAGCTTGCACACACCGGG - Intronic
957970462 3:87375722-87375744 GCCCTGGCCTGGCATCCACTAGG + Intergenic
958128102 3:89383500-89383522 GCCCTGTGCTGGAACTGCCCTGG + Intronic
960457632 3:117892461-117892483 GTCCAGTCCTGGGACTCAACTGG - Intergenic
961357060 3:126345960-126345982 GCCCTGTCTTGTCAGTGACCTGG - Intronic
961743822 3:129050721-129050743 GCCCTGCCCTGGCCCACAGCCGG + Intergenic
962323073 3:134407167-134407189 GCCCTGCCCTGCCACTCGGCAGG + Intergenic
963081776 3:141402020-141402042 GCCTTGTTCTGACAGTCACCAGG + Intronic
966859117 3:184218898-184218920 GTTCTTTCCTGGAACTCACCAGG - Intronic
968541017 4:1168488-1168510 GCCCTGGCCAGGCCCACACCTGG + Intronic
968600311 4:1505587-1505609 CCCCTGCCCTGTCACTGACCTGG + Intergenic
969516925 4:7653063-7653085 GCCTGACCCTGGCACTCACCAGG + Intronic
970603930 4:17661805-17661827 CCCCTCTCCTGGGACTCACTGGG - Intronic
973170964 4:47143188-47143210 GTTCTGACCTGGCAGTCACCAGG - Intronic
984295815 4:177853375-177853397 TCCCTGGCCTGCCGCTCACCAGG - Intronic
986125856 5:4882004-4882026 GCCCTTCCCTGGCACTTACAAGG + Intergenic
986125867 5:4882046-4882068 GCCCTTCCCTGGCACTTACTGGG + Intergenic
986216849 5:5727265-5727287 GCTCTGTCCTGTCAACCACCTGG + Intergenic
986499450 5:8383829-8383851 GCCCTGCTCTGACAGTCACCAGG + Intergenic
987345060 5:16971831-16971853 AGCCTGTCCTGGCACTCAGCGGG - Intergenic
990114067 5:52367380-52367402 GCCCTGACCTGGCAATCCCTAGG + Intergenic
991489067 5:67165758-67165780 GCCCCGGCCTGGCCCTGACCCGG + Exonic
992644553 5:78799818-78799840 GCCCTCTCCTGGCTCTCATAGGG + Intronic
992735545 5:79715625-79715647 CCCCTGCTCTGACACTCACCAGG - Intronic
997526294 5:134555253-134555275 GGCCTGTCCTGCCCCTCACTGGG + Intronic
997740409 5:136248084-136248106 TCCATGTCTTGGCACTCACCAGG + Intronic
997823644 5:137087656-137087678 GCCCTGCCCTGGGACACACATGG - Intronic
999175923 5:149631762-149631784 GCACTGTCCTAGCACTCTACTGG - Intronic
1002053487 5:176585075-176585097 GCCCTGGGCTGGAACTCACAAGG + Intronic
1002388691 5:178892005-178892027 TCTCTGTCCTTGCACTCACCTGG - Intergenic
1002880287 6:1244696-1244718 CCCCTGCCCTGTCCCTCACCGGG - Intergenic
1003121008 6:3319028-3319050 CCTCTGTCCTGGCCCTCACCCGG + Intronic
1006670900 6:35729072-35729094 CGCCTGTCCTGGCACTCTCCAGG - Intergenic
1006797770 6:36742205-36742227 GCCCTGGCCTCCCATTCACCTGG + Exonic
1007030655 6:38623040-38623062 CCCCTTTCCAGCCACTCACCGGG + Intronic
1007116832 6:39348904-39348926 GCTCTGACCGGGCACTGACCGGG + Intronic
1007776273 6:44226164-44226186 TCCCTTTCTGGGCACTCACCAGG - Exonic
1007807831 6:44463758-44463780 GCCCATTCCTGGCACGCAGCAGG + Intergenic
1010562811 6:77371658-77371680 CCCCTGCTCTGGAACTCACCTGG - Intergenic
1011419536 6:87156241-87156263 GCCCTGTCCTGGCTGTCTCCGGG + Intronic
1017526819 6:155248200-155248222 GCCCTGTGCAGGCCCTCGCCCGG - Intronic
1018940817 6:168308084-168308106 GCCCTGGCCTGGGAGGCACCCGG - Exonic
1019452042 7:1104029-1104051 GCCCCGTGCTAGCACCCACCAGG + Intronic
1020131845 7:5563132-5563154 GCCCAGTCCTGGCCCTCTCCGGG + Intronic
1022706887 7:32810270-32810292 GCCCCTGCCTGGCACTCACTTGG + Intergenic
1024216601 7:47254218-47254240 GCCCTGTCCTGGCCCGCCACTGG + Intergenic
1024587783 7:50856431-50856453 GGACTGTCCTGCCTCTCACCTGG - Intergenic
1028790587 7:94849382-94849404 GCCCTGCCGCGGCACTCTCCGGG - Intergenic
1029276508 7:99408398-99408420 GCCCAGGCCTGGCTCTCAGCCGG + Intronic
1030187852 7:106780737-106780759 GCCCTGCTCTGGCCCTCCCCTGG - Intergenic
1032706031 7:134421999-134422021 GCCCTGACCTGGAGCTCACCTGG + Intergenic
1034472589 7:151263436-151263458 GCCCTGTCTTTGCCCTCCCCAGG + Intronic
1035224525 7:157426027-157426049 GCTGTGTCCTTGCACTCACAGGG + Intergenic
1035761282 8:2070582-2070604 GGCAGGTCCTGGCAGTCACCTGG + Intronic
1035950399 8:4013493-4013515 GTCCTGTCCAGGCAGTGACCAGG + Intronic
1036646644 8:10615053-10615075 GCCCAGTCCTGGCCCTCCACAGG + Intronic
1036779314 8:11634709-11634731 GCCCTGCACTAGCTCTCACCTGG + Intergenic
1038421745 8:27438148-27438170 GCGATTTCCTGGCACTCACAGGG - Intronic
1038459206 8:27702383-27702405 GCCCAGTCCTGGCACTGCCTGGG + Intergenic
1038984741 8:32796086-32796108 GCCTTGTCTTGCCACCCACCTGG - Intergenic
1039247951 8:35630565-35630587 ACCCTGTTCTGGCTCTCTCCAGG + Intronic
1039999050 8:42561208-42561230 CCCCTTTCCAGCCACTCACCGGG - Intergenic
1043574673 8:81644057-81644079 GCCCTGCCCAGGTAATCACCAGG + Intergenic
1044933852 8:97275621-97275643 GCCCAGTCCTCACCCTCACCTGG + Exonic
1045418703 8:101992780-101992802 GCCCAGGCCTGGCACACAACAGG + Intronic
1045476783 8:102559725-102559747 GCCCTGGCCTGGCTCTGCCCAGG - Intronic
1049210462 8:141384171-141384193 GCCTTGTCCTGGCACAGGCCTGG + Intergenic
1049475140 8:142793833-142793855 GCCCTGCCAGGGAACTCACCAGG + Intergenic
1049570983 8:143370211-143370233 TCCCTGTCCTGGCCCTCCCTGGG + Intronic
1051620906 9:19048999-19049021 GCCCTGCCCTTGTACTCACTGGG + Intronic
1053691159 9:40588182-40588204 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1053691337 9:40588854-40588876 GCCCTGTCCCAGTACTGACCCGG + Intergenic
1053691491 9:40589423-40589445 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1054272519 9:63044939-63044961 GCCCTGCCCTGGCACTGCCTTGG - Intergenic
1054273312 9:63048062-63048084 GCCCTGCCCTGACACTGTCCTGG - Intergenic
1054273465 9:63048631-63048653 GCCCTGTCCCAGTACTGACCCGG - Intergenic
1054273645 9:63049309-63049331 GCCCTCTCCTGGCACTGACCTGG - Intergenic
1054302419 9:63389153-63389175 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1054302597 9:63389825-63389847 GCCCTGTCCCAGTACTGACCCGG + Intergenic
1054302749 9:63390389-63390411 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1054303539 9:63393512-63393534 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
1054401189 9:64715647-64715669 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1054401369 9:64716325-64716347 GCCCTGTCCCAGTACTGACCCGG + Intergenic
1054401523 9:64716894-64716916 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1054402317 9:64720022-64720044 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
1054434800 9:65199973-65199995 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1054434977 9:65200645-65200667 GCCCTGTCCCAGTACTGACCCGG + Intergenic
1054435131 9:65201214-65201236 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1054435921 9:65204337-65204359 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
1054494471 9:65817350-65817372 GCCCTGCCCTGGCACTGCCTTGG - Intergenic
1054495259 9:65820467-65820489 GCCCTGCCCTGACACTGTCCTGG - Intergenic
1054495412 9:65821036-65821058 GCCCTGTCCCAGTACTGACCCGG - Intergenic
1054495589 9:65821708-65821730 GCCCTCTCCTGGCACTGACCTGG - Intergenic
1055473938 9:76642885-76642907 GCCCTGCCTTGGCCCTCTCCAGG - Intronic
1057783857 9:98072227-98072249 GCCCTGTGCTGGCACCCCACGGG - Intronic
1058051540 9:100411523-100411545 GCTGTGTGCTGGCACCCACCTGG - Intergenic
1060929383 9:127479345-127479367 GGCCTGTGCTGACAGTCACCAGG + Intronic
1061347990 9:130042595-130042617 GCCCGGTCCCGGCCCTCCCCGGG + Intronic
1061994298 9:134176021-134176043 GCTCTGTCCCGGCTCCCACCTGG + Intergenic
1062476369 9:136729357-136729379 GCTCTGTCCTAGCACTGACACGG + Intergenic
1062490932 9:136804624-136804646 GCCCTGGCCTGGGGCTTACCCGG - Exonic
1203621787 Un_KI270749v1:134199-134221 CCCCTGTTCTGGCCCTGACCTGG + Intergenic
1203621802 Un_KI270749v1:134254-134276 TCCCTGTTCTGGCCCTGACCTGG + Intergenic
1203622169 Un_KI270749v1:135614-135636 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1203622944 Un_KI270749v1:138683-138705 GCCCTGCCCTGGCACTGCCTTGG + Intergenic
1185445083 X:253668-253690 GCCTGCTCCTGGCACTCAGCAGG + Intergenic
1186349745 X:8730291-8730313 GCCCTCTCCTGGCTCTGTCCAGG + Intronic
1189192628 X:39123557-39123579 GCCCTGTCCAAGCACCTACCTGG - Intergenic
1189293836 X:39904909-39904931 GCCCTGATCTGTCATTCACCAGG + Intergenic
1194972372 X:100358313-100358335 GTCCTGTCCTGACAGTCACTGGG - Intronic
1195942607 X:110178296-110178318 GCCCTGTTCAGGCTTTCACCTGG + Intronic
1196439092 X:115702245-115702267 GCCTTCTCCTGGCACCCTCCAGG - Intergenic
1199423081 X:147669167-147669189 GCCCTTTCCTGGAACACACCAGG - Intergenic
1200136535 X:153877775-153877797 CCCCTGTCCTGACCCTAACCTGG - Intronic
1201190027 Y:11437515-11437537 GCCCTGTCCCAGTACTGACCTGG + Intergenic
1201190123 Y:11437888-11437910 GCCCTGTCATGGCCCTGCCCTGG + Intergenic
1201190181 Y:11438095-11438117 GCCCTGCCCTGACACTGTCCTGG + Intergenic
1201190463 Y:11439080-11439102 TCCCTGTCCTGGCCCTAGCCTGG + Intergenic
1202583170 Y:26402893-26402915 GCCCTGTCCTGACCCTGTCCTGG - Intergenic
1202583449 Y:26403832-26403854 GCCCTGTCTTGACACTGTCCTGG - Intergenic
1202583504 Y:26404039-26404061 GCCCTGTCATGGCCCTGCCCTGG - Intergenic