ID: 1183060158

View in Genome Browser
Species Human (GRCh38)
Location 22:35331525-35331547
Sequence CCACCGGGATGATGTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183060148_1183060158 15 Left 1183060148 22:35331487-35331509 CCAGCTGGGGTATGGGAGAGGGC 0: 1
1: 0
2: 2
3: 20
4: 232
Right 1183060158 22:35331525-35331547 CCACCGGGATGATGTGAAATGGG 0: 1
1: 0
2: 0
3: 1
4: 67
1183060150_1183060158 -7 Left 1183060150 22:35331509-35331531 CCCTTTGATGGCAGCCCCACCGG No data
Right 1183060158 22:35331525-35331547 CCACCGGGATGATGTGAAATGGG 0: 1
1: 0
2: 0
3: 1
4: 67
1183060145_1183060158 19 Left 1183060145 22:35331483-35331505 CCTACCAGCTGGGGTATGGGAGA 0: 1
1: 0
2: 3
3: 7
4: 189
Right 1183060158 22:35331525-35331547 CCACCGGGATGATGTGAAATGGG 0: 1
1: 0
2: 0
3: 1
4: 67
1183060152_1183060158 -8 Left 1183060152 22:35331510-35331532 CCTTTGATGGCAGCCCCACCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1183060158 22:35331525-35331547 CCACCGGGATGATGTGAAATGGG 0: 1
1: 0
2: 0
3: 1
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183060158 Original CRISPR CCACCGGGATGATGTGAAAT GGG Intronic
900611174 1:3545224-3545246 CCCCAGGGTTGAGGTGAAATCGG + Intronic
908231979 1:62114157-62114179 CTACCGGGATGAGGAGAACTTGG + Exonic
910491444 1:87776941-87776963 CTACAGGGATTCTGTGAAATTGG + Intergenic
912986682 1:114440215-114440237 CCACCAAGATGATGTGCACTTGG - Intronic
915517120 1:156420134-156420156 GCACCTGGCTGAAGTGAAATGGG + Intronic
915544164 1:156586459-156586481 CCACCTGGATGACCTGAAAGAGG - Exonic
923123061 1:231012142-231012164 ACACCGAGATGATGTGAAGATGG - Intergenic
924910393 1:248505801-248505823 CCAACAGAAAGATGTGAAATGGG - Intergenic
924913707 1:248542238-248542260 CCAACAGAAAGATGTGAAATGGG + Intergenic
1072657756 10:97342320-97342342 TCACTGGGATTCTGTGAAATAGG - Intergenic
1074834768 10:117279738-117279760 CCCCCGGGATTAAGTCAAATGGG - Exonic
1079029751 11:16977668-16977690 GCACTGGGATGATGGGAAAGGGG - Intronic
1079156732 11:17954935-17954957 CCAGCATGATGCTGTGAAATAGG - Intronic
1083682192 11:64356799-64356821 CCTCAGAGAGGATGTGAAATTGG + Intronic
1090793713 11:130115487-130115509 TCACAGGGATGATTAGAAATTGG + Intronic
1104744888 12:131204431-131204453 CCAGTGGGATGGTGGGAAATGGG - Intergenic
1113350901 13:109528346-109528368 CCACCTGGTGGATGAGAAATCGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1127070373 15:55282837-55282859 CCCCAGGGATCATGCGAAATGGG - Intronic
1134175763 16:12004754-12004776 CCACGTGGATGATTTGAAACTGG + Intronic
1135851719 16:25969824-25969846 GCTCCTGGATGATCTGAAATGGG - Intronic
1138800176 16:60017146-60017168 ACAAAGGGATGATTTGAAATTGG - Intergenic
1139576466 16:67845524-67845546 CGACCGGGAAGATGTGAGACTGG - Intronic
1144664429 17:17092224-17092246 CCACATGGATGATGTGAATGAGG - Intronic
1146510375 17:33442801-33442823 CCTCCGGTATGATGTTAAGTAGG + Intronic
1147661451 17:42119189-42119211 CAACAGGGAGGATGTGAACTTGG + Intronic
1152173116 17:78767127-78767149 CTACTGGGATGAAGTGAGATGGG - Intronic
1154342340 18:13514303-13514325 CCACAGTAATTATGTGAAATTGG - Intronic
1163005766 19:14395913-14395935 CCACCAGGATGCTGAGAATTTGG + Intronic
1163745444 19:19043827-19043849 CCCCCGTGATGATGTGGCATGGG + Intronic
926075131 2:9936538-9936560 CCACCGGAAGGATGTGAAGAAGG - Intergenic
928753781 2:34500152-34500174 CCACAGAGAAGATGGGAAATTGG + Intergenic
929778017 2:44940644-44940666 CCACCCGGATGAAGTGAATAAGG - Intergenic
934947441 2:98551960-98551982 ACAGCGGGAGGATGTGAAGTTGG + Intronic
937261982 2:120592351-120592373 CCAGCGGGAGGAGGTGAAAGAGG - Intergenic
940116491 2:150214739-150214761 CCAGCCTTATGATGTGAAATAGG - Intergenic
940868469 2:158839609-158839631 CCACTGGGAGGATGTAAAACAGG + Intronic
944163645 2:196693666-196693688 CCTCCTGTATGATGTGGAATAGG + Intronic
945180100 2:207082933-207082955 CCAAGGGAATGAAGTGAAATGGG + Intronic
946497426 2:220208832-220208854 CCTCTGGGAGGAAGTGAAATTGG - Intergenic
1170472585 20:16683051-16683073 CCACAGTGATCATGTGAAAAGGG + Intergenic
1170742900 20:19073401-19073423 CCACCAGGATGATGTGGCTTGGG + Intergenic
1177662110 21:24098239-24098261 ACAAAGAGATGATGTGAAATTGG + Intergenic
1182457681 22:30462256-30462278 CCACCAGGATGACCTGAACTGGG + Intronic
1183060158 22:35331525-35331547 CCACCGGGATGATGTGAAATGGG + Intronic
955985448 3:64569019-64569041 CCACTGGGAAGAGGTGAAAAAGG + Intronic
963545710 3:146655912-146655934 CCACCAGGGTTATGTAAAATAGG + Intergenic
966277697 3:178195321-178195343 CTAACGAAATGATGTGAAATAGG - Intergenic
990378576 5:55198363-55198385 TCACCTGGCTGATGTGACATAGG - Intergenic
991170583 5:63620328-63620350 CTAGCTGGATGATGTGAGATAGG + Intergenic
991617210 5:68509295-68509317 CCTCTGGGATGACATGAAATAGG + Intergenic
993736904 5:91488377-91488399 CCACAGGGCTGAGGTGTAATAGG - Intergenic
994796901 5:104314960-104314982 CCACCGGGATGATTTTTATTGGG + Intergenic
995831919 5:116362965-116362987 ACACTGGGAGGATTTGAAATGGG - Intronic
1000859483 5:166439137-166439159 ACAAAGGGATGATTTGAAATGGG + Intergenic
1011629703 6:89311762-89311784 CCATGGGGATGATGTGAAGATGG - Intronic
1019287121 7:229158-229180 CCTCCGGGTTTGTGTGAAATAGG + Exonic
1027941238 7:84683018-84683040 TCACCGGGATTTGGTGAAATGGG - Intergenic
1029645290 7:101851367-101851389 CCCCCGAGATGATGAGGAATGGG - Intronic
1032373126 7:131380140-131380162 GTACCGGGATGATATGAAACTGG - Intronic
1035556381 8:570178-570200 CCACAGGGAGGATGTATAATGGG - Intergenic
1040091338 8:43401668-43401690 TCACAGGGATGGTCTGAAATTGG - Intergenic
1045058423 8:98390031-98390053 CCTCAGGGCTGATGTAAAATTGG + Intergenic
1046807963 8:118501012-118501034 CCACCCGGTAGATGTGGAATGGG + Intronic
1050595368 9:7199548-7199570 CCACCGGGAGCAAGTGAAACTGG + Intergenic
1051098737 9:13496919-13496941 CCTCCGATATGATGTGAAAAGGG + Intergenic
1051790062 9:20791792-20791814 CCACCAGGTTCATGTGGAATGGG + Intronic
1060688428 9:125633545-125633567 CCACCAGGATTATGTGTAATGGG + Intronic
1192780329 X:74287516-74287538 ACACTGGCATGATGTAAAATGGG + Intergenic