ID: 1183060922

View in Genome Browser
Species Human (GRCh38)
Location 22:35335941-35335963
Sequence CAGCTGCTGTGCGGGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 437}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183060922_1183060932 6 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060932 22:35335970-35335992 ATGCTCTTCACACAGGGAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 223
1183060922_1183060931 5 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060931 22:35335969-35335991 GATGCTCTTCACACAGGGAAGGG 0: 1
1: 0
2: 3
3: 13
4: 171
1183060922_1183060936 23 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060936 22:35335987-35336009 AAGGGGGCAGGATGCTGAGAGGG No data
1183060922_1183060930 4 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060930 22:35335968-35335990 AGATGCTCTTCACACAGGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 179
1183060922_1183060937 26 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060937 22:35335990-35336012 GGGGCAGGATGCTGAGAGGGTGG 0: 1
1: 1
2: 3
3: 77
4: 798
1183060922_1183060933 7 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060933 22:35335971-35335993 TGCTCTTCACACAGGGAAGGGGG 0: 1
1: 0
2: 2
3: 30
4: 215
1183060922_1183060929 0 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060929 22:35335964-35335986 GGAAAGATGCTCTTCACACAGGG 0: 1
1: 0
2: 2
3: 27
4: 188
1183060922_1183060928 -1 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060928 22:35335963-35335985 GGGAAAGATGCTCTTCACACAGG 0: 1
1: 0
2: 2
3: 20
4: 128
1183060922_1183060935 22 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060935 22:35335986-35336008 GAAGGGGGCAGGATGCTGAGAGG 0: 1
1: 0
2: 7
3: 50
4: 518
1183060922_1183060934 11 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060934 22:35335975-35335997 CTTCACACAGGGAAGGGGGCAGG 0: 1
1: 0
2: 4
3: 31
4: 356
1183060922_1183060938 29 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060938 22:35335993-35336015 GCAGGATGCTGAGAGGGTGGTGG 0: 1
1: 0
2: 3
3: 76
4: 700
1183060922_1183060939 30 Left 1183060922 22:35335941-35335963 CCCTGGCTCCCGCACAGCAGCTG 0: 1
1: 0
2: 5
3: 32
4: 437
Right 1183060939 22:35335994-35336016 CAGGATGCTGAGAGGGTGGTGGG 0: 1
1: 0
2: 3
3: 77
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183060922 Original CRISPR CAGCTGCTGTGCGGGAGCCA GGG (reversed) Intronic
900308109 1:2020694-2020716 TGGATGCTGTGCTGGAGCCATGG + Intronic
900352449 1:2241884-2241906 CTGCTGCTTTTCGGGACCCAGGG + Intronic
900659022 1:3773705-3773727 CAGCTGGGGTCCAGGAGCCAGGG - Intronic
900895482 1:5480152-5480174 CAGATGCTGCGAGGGAGGCACGG - Intergenic
901106719 1:6762089-6762111 CAGCTCCTGGCCGGGTGCCATGG - Intergenic
901952426 1:12759587-12759609 CCGCTGCTCTCCTGGAGCCAGGG - Intronic
902124921 1:14201439-14201461 CAGCTGCTCCGGGGCAGCCAGGG - Intergenic
902841169 1:19074815-19074837 CAGCTGCTGTGTGGTGGTCAGGG + Exonic
903366749 1:22810162-22810184 CAGCTCTTGTGCGGGAGACCTGG + Intronic
903741758 1:25562530-25562552 AAGCTGCAGGGAGGGAGCCAGGG + Intronic
904257080 1:29260622-29260644 CAGCAGCTGTGGGGGCGCGATGG - Exonic
904912211 1:33943696-33943718 CAGCTCCTGTTTGGAAGCCAGGG - Intronic
906538389 1:46565223-46565245 CAGCTGCGGTGTGACAGCCACGG - Intronic
906694660 1:47815961-47815983 CAGGTGCTGTGCGGGGGTCCTGG + Intronic
908175504 1:61551971-61551993 CAGATGCTGTCTGGGAGCTAGGG + Intergenic
908208344 1:61873886-61873908 CAGCTGCTGTGGGGTGGCCCAGG + Intronic
908817236 1:68047050-68047072 CAGTTGCTGGGCTGCAGCCACGG - Exonic
909485129 1:76164203-76164225 CTGCTGCTGTGAGGGTGCAAAGG + Intronic
909848748 1:80433697-80433719 GAGGTGCTGTCTGGGAGCCAGGG + Intergenic
910639694 1:89446468-89446490 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
910716329 1:90235579-90235601 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
911038798 1:93576034-93576056 CAGCTGGTGTCCGTGAGGCAAGG + Exonic
911123549 1:94319589-94319611 CAGCATCTGTGTGGAAGCCAGGG - Intergenic
911530394 1:99036903-99036925 CAGCTGCTCTGCTCCAGCCATGG - Intergenic
911942691 1:104068304-104068326 CAGATGCTGTCTGGGAGCCAGGG + Intergenic
913142826 1:115958343-115958365 CAGCTGCTCTGTGGGAGACCAGG - Intergenic
913465052 1:119132031-119132053 CAGGTGCTGTGCAGTGGCCAAGG + Intronic
914005859 1:143731764-143731786 CAGCTTCTGGGTGGGAGCTAAGG + Intergenic
914098329 1:144563006-144563028 CAGCTTCTGGGTGGGAGCTAAGG + Intergenic
914300650 1:146374608-146374630 CAGCTTCTGGGTGGGAGCTAAGG - Intergenic
914518039 1:148390786-148390808 CAGCTTCTGGGTGGGAGCTAAGG + Intergenic
915693568 1:157715954-157715976 CAGATGCTGTCTGAGAGCCAGGG + Intergenic
917848942 1:179043486-179043508 CAGCTGCAGTGGGAGAGGCATGG - Intronic
918963331 1:191307152-191307174 GAGCTGCTGTGATGGGGCCAGGG - Intergenic
920347701 1:205317369-205317391 CAGCTGCTGTCTGGGAGGCAGGG + Intronic
921296092 1:213705239-213705261 GAGGTGCTGTCCGGGATCCAGGG + Intergenic
921675090 1:217968151-217968173 CAGCTGCAGTGGGGAAGGCATGG + Intergenic
921929302 1:220742137-220742159 GAGATGCTGTCAGGGAGCCAGGG + Intergenic
922215229 1:223514914-223514936 CACCTGCTGTGCCAGAGCCTTGG - Intergenic
922377211 1:224980507-224980529 GAGATGCTGTCTGGGAGCCACGG - Intronic
922848119 1:228706145-228706167 CAGCTGCTGTGAGAGAGCAATGG + Intergenic
1062898770 10:1125944-1125966 CTGCATCTGTGCGGGTGCCATGG - Intronic
1063052597 10:2468887-2468909 CAGGGGCAGTGAGGGAGCCAGGG - Intergenic
1065830203 10:29608356-29608378 CAGCTGCAGTGGGGAAGCCATGG + Intronic
1065921912 10:30400169-30400191 GAGATGCTGTGTGGGAGCCAGGG - Intergenic
1066708306 10:38204372-38204394 GAGGTGCTGTCTGGGAGCCAGGG - Intergenic
1066981202 10:42418210-42418232 GAGGTGCTGTCTGGGAGCCAGGG + Intergenic
1068668281 10:59698594-59698616 CTTCTGCTGTGCAGCAGCCAAGG + Intronic
1069395034 10:67978494-67978516 GAGGTGCTGTCTGGGAGCCAGGG - Intronic
1069987514 10:72294422-72294444 CAGGTGCTGTGTGGGGTCCAGGG + Intergenic
1072452554 10:95550300-95550322 CACCTGCTGTGTGCAAGCCACGG - Intronic
1072630090 10:97139823-97139845 CAGCTGTTCAGCTGGAGCCAAGG - Intronic
1073479474 10:103777424-103777446 CAGCTGGCGTGCGTGGGCCAGGG + Intronic
1073678207 10:105673568-105673590 CAGTTGCTGTGAGAGAGCAATGG + Intergenic
1073678897 10:105680337-105680359 GAGGTGCTGTTCAGGAGCCAGGG - Intergenic
1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG + Intergenic
1074853247 10:117455474-117455496 CAGCTGCTGTGCTCCAGCCTCGG + Intergenic
1075496447 10:122923315-122923337 GAGATGCTGTCTGGGAGCCAGGG - Intergenic
1075651493 10:124130450-124130472 CATCTGCTGTCTGGGAGCCTGGG + Intergenic
1076631221 10:131853352-131853374 CTGCTGCTGTGGGGAGGCCACGG - Intergenic
1076752310 10:132549680-132549702 CAGCTGCAGGGCGGGAGCCGGGG + Intronic
1076795124 10:132794618-132794640 CAGGAGCTGTGGGGGAGCCGGGG + Intergenic
1076807768 10:132867724-132867746 CAGCTGCTGTTTGACAGCCAGGG + Intronic
1076843137 10:133056380-133056402 CAGCACCTGTGCTGGAGCCCAGG + Intergenic
1077043352 11:534159-534181 CAGCTGCTGCGGGCGAGCCCAGG - Intronic
1077254177 11:1573085-1573107 CAGGTGTTGGGCGGGAGCAAGGG + Intergenic
1077395109 11:2316740-2316762 CAGCTGCTAGGAGGGAGCCCCGG + Intronic
1077487708 11:2846633-2846655 CACCTGCTCTGAGGGTGCCAGGG + Intronic
1077720361 11:4622073-4622095 CACTTGCTGTGAGGGAGCAATGG - Intergenic
1078066597 11:8082836-8082858 CAGCTCCTGTGGGGGATTCAGGG + Intronic
1078992712 11:16665565-16665587 GAGATGCTGTCCAGGAGCCAAGG - Intronic
1079504125 11:21133960-21133982 CAGCTGCAGTGGAGGAGGCATGG - Intronic
1079888219 11:26016153-26016175 CAGCTCATGTGTGGGAGCCCGGG + Intergenic
1081991216 11:47338660-47338682 CAGCTGCTGTGTGAGACCGAGGG - Exonic
1081994507 11:47355010-47355032 CAGCTGGCGTCCGGGAGCCGGGG + Exonic
1083328361 11:61885212-61885234 CAGCTGCTGTGTGGGATTCACGG - Intronic
1083328382 11:61885278-61885300 GAGCTGCTATCCAGGAGCCAGGG + Intronic
1084337500 11:68468631-68468653 CAGCTGCTCTGCGGAAGTCAGGG + Intronic
1085194666 11:74661805-74661827 GAGATGCTGTCTGGGAGCCAGGG + Intronic
1085334407 11:75679803-75679825 CAGCTGCAGTGGGGGAGACGCGG - Intergenic
1086847812 11:91773690-91773712 GAGATGCTGTCAGGGAGCCAGGG + Intergenic
1087761869 11:102110847-102110869 CGGCTGCTGCCCGGGATCCATGG - Exonic
1088201462 11:107339779-107339801 CAGCTGTTGTGGGGGGGCCAAGG - Intronic
1090423081 11:126589036-126589058 CAGCTAGTGTGCGGGTGCCCTGG - Intronic
1090910257 11:131111978-131112000 CAGCTGCAGTGGGGGAGGCACGG - Intergenic
1091596221 12:1880881-1880903 GAGCTGCTCTCTGGGAGCCAGGG - Intronic
1091738153 12:2940434-2940456 CACCTTCTGTGCCTGAGCCAGGG - Intronic
1091806914 12:3363486-3363508 CTGCTGGTGTGAGGGATCCAGGG + Intergenic
1093588546 12:20871999-20872021 CAGATGCTGTCTGAGAGCCAAGG + Intronic
1094849603 12:34376486-34376508 CAGCTCATGTGCGGGGCCCAGGG - Intergenic
1095181649 12:39153674-39153696 GAGATGCTGTCCAGGAGCCAGGG + Intergenic
1096343880 12:50828382-50828404 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
1096492491 12:52020429-52020451 CAGGTGCTGTGCTGGAGGGAGGG + Intergenic
1097770000 12:63572448-63572470 ATGCTGCTGTCCAGGAGCCAGGG - Intronic
1098405752 12:70124095-70124117 GAGATGCTGTTTGGGAGCCAGGG - Intergenic
1098498294 12:71162550-71162572 CAGCTGCTGGGTGGGAACCAGGG + Intronic
1101360512 12:104021736-104021758 CAGCTGGAGTGCAGCAGCCATGG - Intronic
1103027125 12:117582779-117582801 CAGCTGCTGTGCGGCTTCTAAGG - Intronic
1103327654 12:120132064-120132086 CACCAGCTGTGTGGGAACCAAGG + Intronic
1103461454 12:121108123-121108145 GAGATGCTGTCTGGGAGCCAGGG - Intergenic
1103570174 12:121839621-121839643 CCGCTGGTGGGCGGGACCCAAGG + Exonic
1103570270 12:121840043-121840065 CAGCTCCTAGGCGGGAGACAGGG + Exonic
1103623682 12:122203822-122203844 CCGCTGCTGTGAGGGAGGCTGGG + Intronic
1103951452 12:124553842-124553864 GAGCTGCTGTGGGGCACCCACGG + Intronic
1103993326 12:124813773-124813795 AACCTGCGGTGAGGGAGCCAAGG + Intronic
1104103081 12:125634047-125634069 GAGGTGCTGTCTGGGAGCCAGGG + Intronic
1104612484 12:130241043-130241065 CAGGAGCTGTCAGGGAGCCATGG + Intergenic
1105460292 13:20579265-20579287 GAGATGCTGTCTGGGAGCCAGGG + Intronic
1105558963 13:21472901-21472923 GAGGTGCTGTCCAGGAGCCAGGG + Intergenic
1106414363 13:29534065-29534087 CAGCTGCTTTGGGGGTGACAGGG - Intronic
1106475423 13:30094225-30094247 CAGGTGCTCTGGGGTAGCCATGG + Intergenic
1106979258 13:35257024-35257046 CAACTGCAGTGGGGGAGGCATGG - Intronic
1107364543 13:39656019-39656041 CCGCTGCTCTGCGGGCGCCGGGG + Intronic
1107524141 13:41213655-41213677 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
1107754121 13:43600559-43600581 GAGATGCTGTCCTGGAGCCAGGG - Intronic
1107774346 13:43822558-43822580 AAGATGCTGTCTGGGAGCCAGGG + Intergenic
1108017151 13:46087273-46087295 CTGCTGCCATGCGGGAGGCACGG - Intronic
1108323990 13:49312327-49312349 CAGTTGCTCTGGGGGAGTCAGGG - Intronic
1109345739 13:61113278-61113300 CAGCTGCAGTGGGGAAGGCAAGG + Intergenic
1109825260 13:67710726-67710748 CGGCTGCTGTGGGGGACCCAAGG + Intergenic
1112337876 13:98529337-98529359 CTGCTGCTGTGGGGGAGGGAGGG - Intronic
1112515650 13:100050677-100050699 CAGCTCCTGTGTGGTAGTCATGG + Intergenic
1113424432 13:110196253-110196275 CAGTGGCTGTGGGGGACCCATGG - Intronic
1113946704 13:114048547-114048569 CAGCTGGGATGCGGGAACCACGG - Intronic
1115448668 14:33520799-33520821 CAGCTGTTGAGTGGGAGGCAAGG + Intronic
1116250924 14:42482125-42482147 TAGCTGCTCTGCGGGGGCCTTGG - Intergenic
1116481144 14:45392523-45392545 GAGGTGCTGTCCAGGAGCCAGGG - Intergenic
1117268448 14:54115482-54115504 AAGCTGTTGTGAAGGAGCCATGG + Intergenic
1118522274 14:66597760-66597782 CAGCTGCAGTGTGGGAGGTAAGG - Intronic
1119568447 14:75648590-75648612 CAGCTGCTGGGACTGAGCCATGG - Intronic
1121023030 14:90593399-90593421 CCGCTGCTGTGCCAGAGCCTGGG - Intronic
1121023042 14:90593440-90593462 CCGCTGCTGTGCCAGAGCCTGGG - Intronic
1122107935 14:99473529-99473551 CAGATGCTGTGCTTGAGCTAAGG - Intronic
1122238491 14:100346220-100346242 CATCTGCTGGGGTGGAGCCATGG + Intronic
1122281929 14:100628766-100628788 CAACCTCTGTGCAGGAGCCATGG - Intergenic
1122881039 14:104690490-104690512 CAGCTGAGCTGCGGGAGCCCTGG - Intronic
1123106949 14:105846130-105846152 CAGCTGCCCTGCAGGGGCCATGG + Intergenic
1124483875 15:30099700-30099722 CAGCAGCTGTGGGAGGGCCAAGG + Intergenic
1124490248 15:30151019-30151041 CAGCAGCTGTGGGAGGGCCAGGG + Intergenic
1124519704 15:30397524-30397546 CAGCAGCTGTGGGAGGGCCAAGG - Intergenic
1124538949 15:30568697-30568719 CAGCAGCTGTGGGAGGGCCAAGG + Intergenic
1124632650 15:31346328-31346350 CAGCTGCTATGCAGGAGCTCAGG - Intronic
1124753285 15:32387310-32387332 CAGCAGCTGTGGGAGGGCCAGGG - Intergenic
1124759700 15:32438875-32438897 CAGCAGCTGTGGGAGGGCCAAGG - Intergenic
1124959642 15:34384863-34384885 CAGCTGCTGTGGGTGAGTCGGGG - Intronic
1124975025 15:34523010-34523032 CAGCAGCTGTGGGAGGGCCAGGG - Intergenic
1124976268 15:34531084-34531106 CAGCTGCTGTGGGTGAGTCGGGG - Intronic
1125477363 15:40056055-40056077 CAGCTGCAGGGTGGCAGCCAGGG + Intergenic
1126182091 15:45795275-45795297 CAGCTGCTGTTAAGGACCCAAGG + Intergenic
1126215093 15:46145831-46145853 CAGCTGCAGTCAGGGAGGCATGG + Intergenic
1129311813 15:74718128-74718150 CTCCTGGTGAGCGGGAGCCACGG + Intergenic
1129342069 15:74892644-74892666 CAGCTCCTGTGGGGTGGCCAGGG - Exonic
1129477388 15:75795340-75795362 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
1129727653 15:77909689-77909711 CAGCAGCTGTGGGAGGGCCAGGG - Intergenic
1129835447 15:78702600-78702622 GAGATGCTGTCTGGGAGCCAGGG + Intronic
1130511868 15:84596001-84596023 GAGATGCTGTCTGGGAGCCAGGG - Intergenic
1131260045 15:90883478-90883500 CAGCTGCGATGCAGGAGCAACGG - Intergenic
1132590601 16:724787-724809 CAGGTGCTGTGCAGCTGCCAAGG - Exonic
1132617319 16:848055-848077 CTGCTGGTGTGTGGGAGCCCAGG + Intergenic
1132978878 16:2724799-2724821 CAGCTGCAGTGGGGGAAGCATGG + Intergenic
1135133391 16:19870684-19870706 CAAATGCTTTGGGGGAGCCAGGG + Intronic
1135303532 16:21350432-21350454 CAGGTGCTGTGGGGGAGCAGAGG + Intergenic
1135590366 16:23700833-23700855 GAGCTGCTGGGAGGGAGGCAGGG + Intronic
1135631995 16:24043126-24043148 CAGCTGCTGTTGAGGATCCAAGG + Intronic
1136300278 16:29329626-29329648 CAGGTGCTGTGGGGGAGCAGAGG + Intergenic
1137225762 16:46506768-46506790 CAGATACTGTCCGGGAGCCAGGG - Intergenic
1137588491 16:49679235-49679257 CAGCTGCAGTTGGGGAGGCATGG + Intronic
1138475710 16:57269606-57269628 CAGCTGCTGAGCTTGAGCCCTGG - Intronic
1139267743 16:65656068-65656090 CACCTGCTCTGCAGGAGACAGGG + Intergenic
1141079170 16:81035852-81035874 GGGCGGCCGTGCGGGAGCCATGG + Exonic
1141596657 16:85101083-85101105 CAGCTGCTGTGAGGAAGCCCAGG + Intronic
1141908026 16:87040513-87040535 CAGCTGGTGTGCTGGAGCCATGG + Intergenic
1141952696 16:87348854-87348876 CAGTTGTTCTGCGGGATCCAGGG - Intronic
1142062007 16:88036390-88036412 CAGGTGCTGTGGGGGAGCAGAGG + Intronic
1143634856 17:8158763-8158785 CTACTGCTGCACGGGAGCCACGG + Intronic
1144016440 17:11200777-11200799 CAGCTGGTGTCCAGGAGCCCAGG + Intergenic
1144848290 17:18231305-18231327 GAGCAGCTGGGCGGGAACCAGGG - Intronic
1146128000 17:30244152-30244174 CAGCTGCTGTGCAGAAGGCTAGG - Intergenic
1146749988 17:35369487-35369509 CAGATGCTATCCAGGAGCCAGGG - Intronic
1147156799 17:38548073-38548095 CAGCTCCAGTGCGGGAGACCTGG - Intronic
1149398700 17:56271622-56271644 CAGCTGCTGTGAGGGTGACCAGG + Intronic
1150213177 17:63452677-63452699 CAGCTGCTCTGTGAGTGCCAGGG + Intergenic
1150462644 17:65365355-65365377 CAGCGGCTCGGCGGGAGGCACGG + Intergenic
1151849326 17:76681095-76681117 CAGGTTCTGTGCGGGATCAAGGG - Intronic
1152569429 17:81115227-81115249 CAGCTGCTCTGCAGGGCCCATGG + Intronic
1152664029 17:81557012-81557034 CAGCTGGTTGGAGGGAGCCAGGG + Exonic
1152739439 17:82012561-82012583 GGGCTGCTGTGCTGGGGCCAAGG + Intronic
1152750325 17:82059595-82059617 CAGCTGCTGAGAGGGAGGCTGGG - Intronic
1152915991 17:83036270-83036292 CAGCTGCTGGGTGGGGGCCCTGG + Intronic
1153118578 18:1691764-1691786 CAGCTGCTCTGAGAGAGCAATGG + Intergenic
1153428098 18:4988135-4988157 CAGCTGCAGTGGGGGAGACTTGG - Intergenic
1154365146 18:13701185-13701207 CAGCTGCTCTGAGGGATCAAAGG - Intronic
1157770213 18:50339125-50339147 CAGCTGCTGGGCGGGAAGGATGG - Intergenic
1159334213 18:67043379-67043401 CAGCTGCAGTGGGGGAGGCGCGG + Intergenic
1159714229 18:71801579-71801601 CAACAGCTGTGCAGGAGGCATGG + Intergenic
1160878927 19:1310862-1310884 CTGCAGCTGTGCGGGCCCCACGG - Intergenic
1161085410 19:2332879-2332901 CAGCTGCTGGGTGGGGGCCCTGG + Intronic
1161104564 19:2436941-2436963 GAGCTTCTGTGCGGGGGCCCAGG - Intronic
1161610937 19:5242267-5242289 CAGTGGCTGTGTGGGAGACAAGG - Intronic
1162439929 19:10686630-10686652 CAGCAGCTGTGCTGGGGACAAGG + Intronic
1163018172 19:14469542-14469564 CAGATGCTGTAGGGGAGGCAGGG - Intronic
1164590669 19:29505160-29505182 CAGCTCCTGGGCCTGAGCCAAGG + Intergenic
1165255830 19:34576852-34576874 CAGCAGCAGGGCGGGAGCTAGGG + Intergenic
1165755998 19:38293348-38293370 CATCTGCTGTGAGGGAGGCGGGG - Intronic
1165906427 19:39197176-39197198 CAGCTGCCGGGCGTGAGCCTCGG - Exonic
1166150710 19:40873209-40873231 GAGATGCTGTCCAGGAGCCAGGG - Intronic
1167259997 19:48452900-48452922 CAGCTGCTGTTCGTGCACCAGGG + Exonic
1167449346 19:49557784-49557806 CAACTGCTGTGCGCCAGGCAGGG - Intronic
1167576387 19:50319987-50320009 CAGGTGCAGTGTGGGAGGCAGGG + Intronic
1168283114 19:55316583-55316605 CAGCTGCTGTGTGGAGGACAGGG + Intronic
926154727 2:10447759-10447781 CACCTGCTGCGCGGCCGCCAGGG + Intronic
927570198 2:24152808-24152830 GAGATGCTGTCTGGGAGCCAGGG + Intronic
927961267 2:27241958-27241980 CAGCTCCTTTGCAGCAGCCATGG + Exonic
928398517 2:30961497-30961519 CAGCTGCTGTGTGCCAGGCATGG - Intronic
928495589 2:31828677-31828699 CAGATGCTGTTTGTGAGCCAAGG + Intergenic
929281660 2:40087047-40087069 GAGATGCTGTCCGAGAGCCAGGG + Intergenic
929444274 2:41990641-41990663 CATCTGCTGTGCTGGAACCCAGG - Intergenic
930026372 2:47031648-47031670 CCGCTGCTCTGATGGAGCCAAGG + Intronic
930052246 2:47225547-47225569 CAGCTGCTCTGCAGAACCCAGGG - Intergenic
930944820 2:57061182-57061204 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
931406840 2:61987792-61987814 GAGATGCTGTCTGGGAGCCAGGG + Intronic
932161099 2:69460689-69460711 CAGCTGCTGAGCAGCACCCAGGG - Intronic
936608197 2:113978107-113978129 CAGCTGCTGTGGATGAGTCATGG + Intergenic
936844674 2:116816401-116816423 CAGATGCTATGAGAGAGCCAGGG - Intergenic
936925412 2:117731467-117731489 GAGATGCTGTTTGGGAGCCAGGG - Intergenic
937560625 2:123219491-123219513 GAGGTGCTGTCTGGGAGCCAGGG - Intergenic
938071289 2:128309800-128309822 CAGCAGCTGTCCGCGTGCCATGG - Intronic
939963336 2:148585706-148585728 TAGATGCTGTCGGGGAGCCAAGG + Intergenic
940422954 2:153500011-153500033 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
940546942 2:155100725-155100747 GAGATGCTGTCTGGGAGCCAGGG - Intergenic
940947847 2:159637890-159637912 GAGATGCTGTCTGGGAGCCAAGG - Intergenic
942294993 2:174508344-174508366 GAGATGCTGTCTGGGAGCCAGGG - Intergenic
942862856 2:180636569-180636591 GAGATGCTGTCTGGGAGCCAGGG - Intergenic
943427826 2:187758792-187758814 GAGGTGCTGTCCAGGAGCCAGGG + Intergenic
944990457 2:205229782-205229804 CAGATGCCGTCCAGGAGCCAGGG + Intronic
945234817 2:207624771-207624793 CAGCTGCAGTCCGGGCGCCCGGG - Intronic
945395256 2:209307927-209307949 CAGCTGCAGTGGGCGAGGCAAGG - Intergenic
945754393 2:213829151-213829173 GAGTTGCTGTCTGGGAGCCAGGG + Intronic
946713645 2:222531508-222531530 CAGCAGCTGTCAGGGAGACAGGG + Intronic
947347328 2:229206713-229206735 CATCTGCTGGGCTGAAGCCAAGG + Intronic
948392951 2:237625946-237625968 CAGCTGCTGAGCTGGAGGCTGGG - Intergenic
948531813 2:238613703-238613725 CAGCTCCAGTGCTGGGGCCAGGG + Intergenic
948567148 2:238894439-238894461 CAGCAGCTGTGCAGGCGGCAAGG - Intronic
948750558 2:240129971-240129993 TCGCTGCAGTGCGGGAACCATGG + Exonic
1169234328 20:3917461-3917483 CTGCTGAGGTGGGGGAGCCAAGG - Intronic
1170568973 20:17622314-17622336 CAGTTGATGTGTGAGAGCCAGGG + Intronic
1170597760 20:17818368-17818390 CAGCTGCCGTGACTGAGCCAGGG - Intergenic
1170834743 20:19874581-19874603 CAGGTACTGTGAGGGAGTCAGGG - Intergenic
1171445034 20:25196749-25196771 CACCCGCTGTGCAAGAGCCATGG + Intronic
1171767952 20:29300575-29300597 CAGCGGCAGTGGGGGAGCCGCGG - Intergenic
1172763162 20:37336291-37336313 CAGCTCCTGTGCTGGAGCTGGGG - Intergenic
1172763271 20:37336697-37336719 CAGCTGGTGAGTGGGAGGCAGGG + Intergenic
1172834732 20:37865771-37865793 CAGCCACTGTGCAGTAGCCATGG - Intronic
1173004088 20:39126523-39126545 GAGGTGCTGTCCAGGAGCCAGGG + Intergenic
1173011821 20:39190088-39190110 CAGGCACTGTGCTGGAGCCAGGG + Intergenic
1173395788 20:42678125-42678147 CAGCAGCTCTGGGGGAGCAATGG + Exonic
1174831790 20:53820228-53820250 CAGGTGCTGTTCGGGAGCCAGGG + Intergenic
1175219955 20:57411159-57411181 CATGTACTGTGTGGGAGCCAGGG - Intergenic
1175422203 20:58841527-58841549 CAGCTGCCGTGCGCCAGCCTTGG + Intronic
1175791582 20:61743570-61743592 CAGCAGCTGTGTGGGGACCAAGG + Exonic
1175853113 20:62104367-62104389 AACCTGCGGTCCGGGAGCCATGG + Intergenic
1175891347 20:62317371-62317393 CAGCTGCTGTGCGTGGGCCTCGG + Exonic
1176063581 20:63182783-63182805 CAGATGCTCTGATGGAGCCATGG + Intergenic
1176102089 20:63368962-63368984 CAGCTGCTGAGAATGAGCCAAGG + Intronic
1176170504 20:63694405-63694427 CAGCTGCTGGGCTGCAGCCGTGG - Exonic
1176995018 21:15544758-15544780 GAGATGCTGTTTGGGAGCCAGGG - Intergenic
1177222173 21:18209140-18209162 GAGATGCTGTCCAGGAGCCAGGG + Intronic
1178678068 21:34647667-34647689 CAGCCACTGTGCTGGGGCCAGGG - Intergenic
1179642366 21:42756134-42756156 GATCTGCTGGGCAGGAGCCACGG - Intronic
1179857905 21:44171633-44171655 AAGCAGCAGTGCAGGAGCCAGGG - Intergenic
1179996239 21:44975731-44975753 CAGCTGCCATGCTGGGGCCAGGG + Intronic
1181083547 22:20429036-20429058 CAGCTGCTGAGGGCGAGGCAAGG - Intronic
1181454174 22:23046803-23046825 CAGTTGCTGTGAGAGAGCAATGG + Intergenic
1181456792 22:23064410-23064432 CAGCTGCTGTGCGCTTGCTATGG - Intronic
1181491352 22:23262643-23262665 CAGCTGCTCTTGGGCAGCCAGGG + Intronic
1182509294 22:30807580-30807602 CAGCTGCTGTGTGAGAGGCAGGG - Intronic
1183060922 22:35335941-35335963 CAGCTGCTGTGCGGGAGCCAGGG - Intronic
1183270749 22:36861170-36861192 CAGCTGCTGGGCCACAGCCATGG - Exonic
1183472978 22:38019368-38019390 CAGCTGCTGGGCAGTAGTCACGG - Intronic
1183786513 22:40032060-40032082 AAGCTGCTGTGCAGGGACCAAGG - Exonic
1184571837 22:45329870-45329892 CTGCTGCTGTGCGGGCTCCGGGG + Intronic
949226907 3:1705647-1705669 CAGATGCTGTGCTGGTCCCATGG + Intergenic
949311833 3:2708491-2708513 TAGCTGCTGTGCGGAAGCTCTGG + Intronic
951230954 3:20179212-20179234 CAGCATCTGTGGGGGAGACAAGG + Intronic
951259848 3:20495006-20495028 GAGATGCTGTTTGGGAGCCAGGG + Intergenic
951562564 3:23982666-23982688 CAGCTGGTGTGATGCAGCCATGG + Intergenic
952023968 3:29056715-29056737 CAGCTGCTTTGAGAGATCCATGG + Intergenic
952174173 3:30843595-30843617 CACCTGCTGTGCTCCAGCCAAGG - Intronic
952639844 3:35580102-35580124 GAGTTGCTGTCTGGGAGCCAGGG - Intergenic
953792994 3:45962651-45962673 CAGCCCCTGTCCAGGAGCCAAGG - Intronic
954023665 3:47764608-47764630 GGGCTGCTGTGCTGGAGACATGG - Intronic
954459779 3:50619694-50619716 CAGATGCTGTGGGTGAGTCAGGG + Intronic
954717447 3:52533679-52533701 TGGCTGCTGTGCGGAGGCCACGG - Exonic
955513926 3:59708014-59708036 CAGCGGCTGTGCATGAGGCACGG + Intergenic
957613912 3:82505178-82505200 CAGCTGCAGTGGGGGAGGCAGGG + Intergenic
958148706 3:89660755-89660777 CAGAGGCTGTAAGGGAGCCAAGG + Intergenic
958584596 3:96069629-96069651 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
958876751 3:99625215-99625237 GAGGTGCTGTCTGGGAGCCAGGG - Intergenic
960471788 3:118075197-118075219 GAGGTGCTGTCTGGGAGCCAGGG + Intergenic
961302491 3:125931074-125931096 CAGCTCCTGAGCAGGGGCCAAGG + Intronic
961313180 3:126016714-126016736 CAGCAGGTGAGCAGGAGCCAGGG - Exonic
961385479 3:126521212-126521234 CTGCTGCTCTGTGGGAGGCAGGG - Intergenic
961426859 3:126855281-126855303 GAATTGCTGTGTGGGAGCCAAGG - Intronic
962415287 3:135176486-135176508 CAGCTGCTGTTCTGGGGCCATGG - Intronic
962483394 3:135817000-135817022 GAGATGCTGTCCAGGAGCCAGGG - Intergenic
962759055 3:138492305-138492327 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
963390412 3:144656236-144656258 CAGCTGATGTATGAGAGCCATGG - Intergenic
964418139 3:156471607-156471629 CAGCTGCCCTTCTGGAGCCAAGG + Intronic
964810164 3:160654631-160654653 GAGATGCTGTCTGGGAGCCAGGG - Intergenic
965652996 3:170953177-170953199 CAGCAGCTGTGATGGTGCCAGGG - Intergenic
965975282 3:174613396-174613418 CAGATGCTGTCCAGGAGTCAGGG + Intronic
967858470 3:194134919-194134941 CAGCTGCTGTGCTCGAGCCTGGG - Intergenic
967936063 3:194728723-194728745 CAGCTACTGTTGGGAAGCCAAGG - Intergenic
968469031 4:769211-769233 CAGCTGCAGTGCTTGGGCCAGGG - Exonic
968622510 4:1610295-1610317 CAGCTGGGGTCCGGGGGCCAGGG - Intergenic
968813559 4:2810655-2810677 GAGCTGGGGTGAGGGAGCCACGG - Intronic
969152378 4:5180504-5180526 CAGCTGCTGTGATGGGGCCCTGG + Intronic
969411893 4:7033890-7033912 CAGCTGCTCTGCGGATGACAGGG + Intergenic
969548832 4:7850694-7850716 CTGCTGGTGTGGGGCAGCCATGG + Intronic
969600300 4:8172102-8172124 CAGCTGCTGTGAGGGAGCCGTGG + Intergenic
973224997 4:47774229-47774251 CAGCTGCAGTGCGGGAGGCATGG + Intronic
974414903 4:61594791-61594813 GAGATGCTGTCTGGGAGCCAAGG + Intronic
975369428 4:73567864-73567886 GAGATGCTGTCCAGGAGCCAAGG + Intergenic
975503969 4:75117763-75117785 GAGGTGCTGTCCAGGAGCCAGGG - Intergenic
975592708 4:76016692-76016714 GAGATGCTGTCTGGGAGCCAGGG + Intronic
979166560 4:117539850-117539872 CAGCTGCTGTGCAGGAGAAAAGG + Intergenic
979213220 4:118132183-118132205 GAGATGCTGTCTGGGAGCCAAGG + Intronic
980493531 4:133560900-133560922 CAGCTGCAGTGGGGGAGGCGTGG - Intergenic
980574488 4:134666933-134666955 CAGCTGCAGTTTGGGAGGCATGG - Intergenic
981895717 4:149796438-149796460 GAGGTGCTGTCCAGGAGCCAGGG - Intergenic
982781941 4:159500346-159500368 CAGCAGCTGAGTGGGAGTCAGGG - Intergenic
982901159 4:161003921-161003943 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
983165897 4:164477182-164477204 GAGCTACTGTCCAGGAGCCAGGG + Intergenic
983219647 4:165032062-165032084 CTGATGCTGTGCAGGACCCATGG - Exonic
983403441 4:167295086-167295108 CAGCTCCTGTGTGGGAGCCCTGG - Intergenic
983653548 4:170057006-170057028 TAGCTTCTGTGTGGAAGCCATGG - Intergenic
984153013 4:176157977-176157999 TAGCTGGAGTGCAGGAGCCAGGG + Intronic
984170324 4:176350915-176350937 CAGCTGCAGTGGGGGAGGCGTGG - Intergenic
988922291 5:35954409-35954431 CAGCCGCTGTGCGGGGCTCAGGG + Exonic
990165446 5:52989150-52989172 GGGCCGCTGTACGGGAGCCAAGG + Intergenic
990827955 5:59922923-59922945 TAACTGCTGTCCGAGAGCCAGGG - Intronic
991712126 5:69418013-69418035 CAGCTGGAGTGCTTGAGCCAGGG + Intronic
992151949 5:73913646-73913668 CAGCTGATGTGCCAGAACCAAGG + Intronic
992415122 5:76545257-76545279 CAGCTACTGTTTGGGAGCAAGGG + Intronic
992860050 5:80900329-80900351 CAGATGCTTTGTGGGGGCCAGGG - Intergenic
993001412 5:82384988-82385010 CAGCTGCTGTGGTGGCCCCATGG + Intronic
994239909 5:97407450-97407472 CTGCCGCTGTGCAGGAGCCCAGG - Intergenic
994619851 5:102150238-102150260 GAGCTGGTGTGGGGGAGACAGGG - Intergenic
994753348 5:103764887-103764909 CAGCTGTAGTGGGGGAGGCATGG - Intergenic
997003114 5:129785267-129785289 GAGATGCTGTCCGGGACCCAGGG - Intergenic
997254376 5:132417167-132417189 AAGCTGCTGGGCTGTAGCCAGGG + Intronic
997337297 5:133117348-133117370 CAGCTGCTGTGCCTGCTCCAAGG - Intergenic
997843263 5:137261891-137261913 CAGGTTCTCTGCTGGAGCCAGGG - Intronic
998182988 5:139958297-139958319 GGGCTGCTGTGTGGGAGCTAGGG + Intronic
998215855 5:140238242-140238264 CAGCTGCTGTTGTGGAGCCTGGG + Intronic
999002464 5:147939373-147939395 AAGGTGCTGTCCAGGAGCCAGGG + Intergenic
999153442 5:149441873-149441895 CAGCTGTTGTTTGGGAGCCCCGG + Intergenic
999187702 5:149725036-149725058 CAGCTTCTGTCCAGGAGGCAGGG - Intergenic
999252319 5:150190215-150190237 CAGCCGGTGCGCGGGAGCCGCGG + Exonic
999849432 5:155522828-155522850 GAGGTGCTGTCCAGGAGCCAGGG + Intergenic
1002070154 5:176674262-176674284 GTGCTGCTGTCAGGGAGCCAGGG - Intergenic
1002688919 5:181037111-181037133 GAGCTCCTGGGTGGGAGCCAGGG + Intergenic
1003551515 6:7106357-7106379 GAGCTGGTGTGGTGGAGCCAGGG + Intergenic
1003881474 6:10483234-10483256 CAGGTGCTGAGAGCGAGCCAGGG + Intergenic
1004160192 6:13206006-13206028 CAGCTGCAGTACGGCAGCCACGG + Exonic
1004184466 6:13410198-13410220 CAGCTGCATTGCCAGAGCCAGGG - Intronic
1006018509 6:31102665-31102687 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
1007397770 6:41587282-41587304 CAGCTGCTGTGGGAGAGACAGGG - Exonic
1007406030 6:41637033-41637055 CGGCTGCTGTCCGGGAGCTCTGG - Intronic
1007585658 6:42987672-42987694 CACCTGTTCTGCAGGAGCCAGGG + Intronic
1007665834 6:43512519-43512541 CAGCCGCTGTGTGGGGCCCACGG + Exonic
1009309074 6:62126372-62126394 GAGATGCTGTCCGGGAGCCAGGG - Intronic
1011791789 6:90906851-90906873 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
1012100698 6:95083453-95083475 CAGCTGCAGCGGGGGAGGCATGG + Intergenic
1012717727 6:102698562-102698584 CAGATGGTGTCCCGGAGCCATGG + Intergenic
1013680508 6:112520547-112520569 CAGTTGCTCTGAGGGAGCAATGG + Intergenic
1014717128 6:124879561-124879583 CAGCTGCAGCTCTGGAGCCAGGG + Intergenic
1015052758 6:128862537-128862559 GAGATGCTGTCAGGGAGCCAGGG + Intergenic
1015959511 6:138632247-138632269 CAGGTGCTGTCTGGGAGTCAGGG - Intronic
1017924747 6:158901243-158901265 GAGATGCTGTCTGGGAGCCAGGG + Intronic
1018839061 6:167506059-167506081 CAGCTGCTGAACGGAAGCCCGGG + Intergenic
1018974768 6:168556152-168556174 CCGCGGCTGTGCGGGAGGGAAGG + Intronic
1022366899 7:29730322-29730344 ATGCTGCTGTCCAGGAGCCAGGG + Intergenic
1022396091 7:29989361-29989383 CGGCTGCGGTGCGGGAGCCCGGG + Intronic
1022746133 7:33174230-33174252 CAGTTGCTGTGAGAGAGCAATGG + Intronic
1026121001 7:67537595-67537617 CAGATGCTGTTCATGAGCCAAGG - Intergenic
1026990988 7:74585584-74585606 CAGCTACTGTAGGGGAGCCTGGG + Intronic
1027682127 7:81233794-81233816 CAGCTGCTGCAGGGGAGGCATGG - Intergenic
1029002433 7:97168063-97168085 CAGCTTATGTGTGGGAGCCCTGG + Intronic
1029308462 7:99639467-99639489 AAGCAGCAGTGCTGGAGCCAGGG - Intergenic
1029825364 7:103187137-103187159 ATGCTGCTGTCCAGGAGCCAGGG - Intergenic
1031288306 7:119900455-119900477 GAGATGCTGTGCTGGAGCAAGGG + Intergenic
1031472492 7:122183118-122183140 AAGGTGCTGTTCAGGAGCCAGGG - Intergenic
1031546110 7:123053123-123053145 GAGATGCTGTCCAGGAGCCAGGG + Intergenic
1031862359 7:126994771-126994793 GAGATGCTGTCTGGGAGCCAGGG - Intronic
1031929229 7:127667545-127667567 CAGCTGCTGTTCCTGATCCAGGG - Intronic
1033564545 7:142565923-142565945 CAGCAGCTCTGCCAGAGCCAAGG + Intergenic
1034038639 7:147851969-147851991 TTGCTGCTGTGCTGCAGCCAAGG - Intronic
1034192892 7:149224847-149224869 CAGCTGCTGGGGAAGAGCCAGGG + Exonic
1034632067 7:152538826-152538848 CAGCCCCGGTGCGGGATCCACGG - Intergenic
1034965364 7:155387409-155387431 CAGCCCCTCTGCGGGAGGCACGG - Intronic
1035242868 7:157543531-157543553 CAGCGGGTGTCCGAGAGCCATGG - Intronic
1035305889 7:157931094-157931116 ATGCTGCAGTGCTGGAGCCATGG - Intronic
1036723897 8:11201609-11201631 CAGCTGCTGGGCGGGGGACCGGG + Intergenic
1036847684 8:12181025-12181047 CGGCTGCTGAGCAGGGGCCAAGG - Intergenic
1036869052 8:12423340-12423362 CGGCTGCTGAGCAGGGGCCAAGG - Intergenic
1036936265 8:13004962-13004984 GAGGTGCTGTCTGGGAGCCAGGG - Intronic
1039638552 8:39193861-39193883 CTGCTTCTGTGGAGGAGCCATGG + Intronic
1040404387 8:47086069-47086091 CAGCTGGGGTGGGGGGGCCAGGG + Intergenic
1040988543 8:53323509-53323531 CAGCTGCTATGAGTGAGGCATGG + Intergenic
1041128169 8:54666672-54666694 CAGCTGCTGTCCCGGGGTCAGGG - Intergenic
1042566626 8:70118082-70118104 CACCTGCTCTGCTGGAGCCCTGG + Intronic
1043082693 8:75785253-75785275 CAGCTGCAGTGAGTGAGGCATGG - Intergenic
1043195380 8:77286831-77286853 CAGCTGCAGTGGGGGAGGCATGG + Intergenic
1043760508 8:84062581-84062603 GAGGTGCTGTCCAGGAGCCAGGG + Intergenic
1044775111 8:95678881-95678903 CAGTTGCAGTGGGGGAGGCACGG - Intergenic
1045159543 8:99523241-99523263 GAGATGCTGTCCAGGAGCCAGGG - Intronic
1045172115 8:99682851-99682873 GAGATGCTGTCCAGGAGCCAGGG + Intronic
1045172457 8:99686470-99686492 GAGATGCTGTCCAGGAGCCAGGG + Intronic
1047314015 8:123715781-123715803 CAGCGGTTGAGTGGGAGCCAAGG + Intronic
1048690166 8:136954130-136954152 CAGCTCCTGTGGGCGATCCAAGG - Intergenic
1049249985 8:141583069-141583091 CAGCTGCTGTACTGGTGCCCGGG + Intergenic
1049305311 8:141899711-141899733 CTGCTGCTGTCTGGGAGACAAGG - Intergenic
1049537427 8:143188862-143188884 CAGCAGCTGTGCGGGTGACCTGG - Intergenic
1049726087 8:144147227-144147249 CAGCTGGTGTGCGTGAGGCGGGG + Intergenic
1050589835 9:7149543-7149565 CAGCTGCAGCGAGGGAGGCATGG - Intergenic
1050807087 9:9694578-9694600 GAGATGCTGTCCGGAAGCCAGGG + Intronic
1050865127 9:10488576-10488598 GAGGTGCTGTCTGGGAGCCAGGG + Intronic
1050937124 9:11413208-11413230 CGGCTGCAGTGGGGGAGGCATGG + Intergenic
1051029776 9:12659194-12659216 CAGCTGCAGTGGGGAAGGCATGG - Intergenic
1052420324 9:28234988-28235010 GAGATGCTGTGTGGAAGCCAGGG - Intronic
1053153281 9:35756521-35756543 CGGCTGCGGTGTGGGAGGCACGG + Exonic
1055708934 9:79037578-79037600 CAGCGTCTATGCGGGCGCCAGGG - Intergenic
1057701110 9:97363800-97363822 CAGCTGCTGTGAGAGGGCAAGGG - Intronic
1058731853 9:107857986-107858008 CAGCTGCTGTGAGAGAGCGATGG + Intergenic
1060107731 9:120884428-120884450 GAGCTGCTCCCCGGGAGCCAAGG + Intronic
1060304509 9:122398619-122398641 GAAATGCTGTGCGAGAGCCAAGG - Intergenic
1060897306 9:127225770-127225792 CAGCAGGTGTGCGGCTGCCAGGG - Intronic
1060934010 9:127505642-127505664 CTGCTGCTTTGCGGGGGGCAGGG - Exonic
1061448872 9:130658174-130658196 CAGCTACTGGTCAGGAGCCAAGG - Intergenic
1061621215 9:131812471-131812493 CTGCTGCTTTGGGGCAGCCAGGG - Intergenic
1061638356 9:131929766-131929788 CAGATGCTGTCTGAGAGCCAGGG - Intronic
1061721926 9:132557226-132557248 CAGCTGCTGTGCAGGGGCCAGGG - Intronic
1061866373 9:133493611-133493633 CAGCTGCTGTCCTGGGGTCACGG + Intergenic
1062103596 9:134740789-134740811 CAGCTGCCGTGGAGGAGCCAAGG + Intronic
1062381594 9:136289578-136289600 CAGCCCTTGTGGGGGAGCCATGG - Intronic
1062400996 9:136372590-136372612 CAGCTGCTGTGCTGGTGGGAGGG - Intronic
1062453923 9:136626970-136626992 CAGCTGGTGCCCGTGAGCCAGGG - Intergenic
1186649209 X:11540899-11540921 CAGCTGCTGTGCACCAACCATGG + Intronic
1187526128 X:20056741-20056763 CAGCTGCTGTGTGCGCTCCAGGG + Exonic
1187588414 X:20689591-20689613 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
1187651995 X:21420014-21420036 GAGGTGCTGTCTGGGAGCCAGGG + Intronic
1187871376 X:23767453-23767475 CAGCTGTAGTGTGGGAGGCACGG - Intergenic
1188715685 X:33456865-33456887 GAGGTGCTGTCCAGGAGCCAAGG - Intergenic
1188864693 X:35300431-35300453 GAGATGCTGTCCTGGAGCCAGGG - Intergenic
1189116948 X:38352581-38352603 CAGTTGCAGTGAGGGAGCAAAGG - Exonic
1189411813 X:40779422-40779444 GAGATGCTGTTTGGGAGCCAGGG + Intergenic
1190050732 X:47146744-47146766 CAGTTGCTGTGTGAGGGCCAAGG + Intronic
1190588086 X:51967413-51967435 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
1192078569 X:68024952-68024974 CAGTTGCAGTGAGGGAGCAAGGG - Intergenic
1192135122 X:68589691-68589713 GAGATGCTGTCTGGGAGCCAGGG - Intergenic
1192423954 X:71059511-71059533 CAGCTGCTGAGCCTGCGCCAGGG - Exonic
1193293740 X:79809247-79809269 GAGATGCTGTCCAGGAGCCAGGG + Intergenic
1193613374 X:83659204-83659226 CAGCTGCTGTTAAGGAGCCTGGG - Intergenic
1194550472 X:95291698-95291720 GAGGTGCTGTCCAGGAGCCAGGG - Intergenic
1194558668 X:95394058-95394080 GAGATGCTGTCTGGGAGCCAAGG - Intergenic
1194891592 X:99385239-99385261 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
1195971444 X:110477901-110477923 GAGATGCTGTCTGGGAGCCATGG + Intergenic
1196242974 X:113365563-113365585 GAGATGCTGTCTGGGAGCCAGGG + Intergenic
1196357228 X:114809115-114809137 GAGTTGCTGTCTGGGAGCCAGGG + Intronic
1198537633 X:137601856-137601878 GAGATGCTGTCTGGGAGCCAAGG - Intergenic
1198612059 X:138412164-138412186 GAGGTGCTGTACAGGAGCCAGGG - Intergenic
1198785399 X:140282964-140282986 GAGGTGCTGTCCAGGAGCCAGGG + Intergenic
1198927394 X:141814475-141814497 GAGGTGCTGTGTGGGAGTCAGGG + Intergenic
1199148365 X:144397882-144397904 GAGGTGCTGTCCAGGAGCCAGGG - Intergenic