ID: 1183068577

View in Genome Browser
Species Human (GRCh38)
Location 22:35380716-35380738
Sequence TGCACCCCAGGCGTCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 122}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183068577_1183068587 8 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068587 22:35380747-35380769 CAAGGGGACAGGGAGCAGAAGGG 0: 1
1: 0
2: 3
3: 66
4: 680
1183068577_1183068580 -9 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068580 22:35380730-35380752 TGGGGTGCATCAAGTCCCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 65
1183068577_1183068589 10 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068589 22:35380749-35380771 AGGGGACAGGGAGCAGAAGGGGG 0: 1
1: 1
2: 9
3: 168
4: 1364
1183068577_1183068591 12 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068591 22:35380751-35380773 GGGACAGGGAGCAGAAGGGGGGG 0: 1
1: 1
2: 9
3: 152
4: 1449
1183068577_1183068582 -3 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068582 22:35380736-35380758 GCATCAAGTCCCAAGGGGACAGG 0: 1
1: 0
2: 0
3: 8
4: 138
1183068577_1183068593 22 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068593 22:35380761-35380783 GCAGAAGGGGGGGCTCTGGAAGG 0: 1
1: 0
2: 3
3: 36
4: 396
1183068577_1183068588 9 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068588 22:35380748-35380770 AAGGGGACAGGGAGCAGAAGGGG 0: 1
1: 0
2: 7
3: 108
4: 1001
1183068577_1183068586 7 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068586 22:35380746-35380768 CCAAGGGGACAGGGAGCAGAAGG 0: 1
1: 0
2: 1
3: 75
4: 618
1183068577_1183068592 18 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068592 22:35380757-35380779 GGGAGCAGAAGGGGGGGCTCTGG 0: 1
1: 0
2: 8
3: 49
4: 625
1183068577_1183068583 -2 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068583 22:35380737-35380759 CATCAAGTCCCAAGGGGACAGGG 0: 1
1: 0
2: 0
3: 14
4: 222
1183068577_1183068579 -10 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068579 22:35380729-35380751 CTGGGGTGCATCAAGTCCCAAGG 0: 1
1: 0
2: 0
3: 8
4: 125
1183068577_1183068590 11 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068590 22:35380750-35380772 GGGGACAGGGAGCAGAAGGGGGG 0: 1
1: 0
2: 11
3: 183
4: 1376
1183068577_1183068581 -8 Left 1183068577 22:35380716-35380738 CCTTCTGGGACGCCTGGGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 122
Right 1183068581 22:35380731-35380753 GGGGTGCATCAAGTCCCAAGGGG 0: 1
1: 0
2: 1
3: 3
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183068577 Original CRISPR TGCACCCCAGGCGTCCCAGA AGG (reversed) Intronic
900437020 1:2635608-2635630 TGCACCCCAGACGTGCCCAACGG + Intergenic
900488140 1:2933189-2933211 TGCACCCCCGAGGCCCCAGAGGG - Intergenic
900540145 1:3198539-3198561 TGCTGCCCACGCGTCCCAGAAGG - Intronic
901618378 1:10560490-10560512 TGCACACCTGTGGTCCCAGATGG - Intronic
902719305 1:18293422-18293444 TGCTCCCCAGGCGGCCCGGCTGG + Intronic
902916174 1:19640971-19640993 TGGACCCCAGGGGCCCCAGCGGG - Intronic
903339907 1:22647319-22647341 GGCACCCCTGGCATCCCAGGGGG - Exonic
904238342 1:29128147-29128169 TGGAGCCCAGGCAGCCCAGATGG - Intergenic
905301923 1:36991466-36991488 AGCACCCCAGCTGTCCCAGAGGG + Intronic
906108373 1:43307888-43307910 TGCACTCCATGCCACCCAGAGGG - Exonic
910976301 1:92909720-92909742 TGCAACCTAGGCATCCCAAAAGG + Intronic
915165754 1:153946815-153946837 CTGACCCCAGGCGACCCAGAGGG + Intergenic
915166679 1:153951879-153951901 TGCACCCCAGGATTCCCTCACGG - Intronic
915355257 1:155251857-155251879 TGCAGCCCAGAGGTCCCAGTGGG + Exonic
918122979 1:181556241-181556263 TGCACCCCATCCACCCCAGAGGG - Intronic
921053314 1:211526517-211526539 GGCACCCCAGGCATGCCCGAGGG + Intergenic
924656976 1:245981352-245981374 TGCAGCCCAGGGCTCCCAGAGGG - Intronic
1062819781 10:526004-526026 TCCACGCCAGGCGTTGCAGAAGG - Intronic
1062836392 10:638954-638976 TGCCCTCCTGGCTTCCCAGAAGG + Intronic
1063204051 10:3813678-3813700 AGCACCCCAGGTGTCCCGGCAGG - Intergenic
1064568109 10:16663999-16664021 TACACTCCAGGAGTCACAGAAGG + Intronic
1067152263 10:43746526-43746548 TGCACCCCAGGCTTACGATATGG - Intergenic
1069916341 10:71789403-71789425 TGCTCCCCAGGGCTTCCAGAAGG - Intronic
1070739083 10:78890619-78890641 AGCAGCCTAGGCATCCCAGAAGG + Intergenic
1070783855 10:79151963-79151985 AGCAGCCCAGGGGGCCCAGATGG - Intronic
1073350181 10:102813945-102813967 TGCACCCCATGCGTCCTTGAGGG + Exonic
1076379321 10:130014432-130014454 TGCACCCCAGTCATCCCGGCGGG + Intergenic
1083678683 11:64341589-64341611 TGCGCCCCAGGTGACCCAGCCGG + Exonic
1084503101 11:69546447-69546469 AGCACCCCAGCTGTCCCAGCAGG + Intergenic
1085016434 11:73177145-73177167 TAGAGCCCAGGTGTCCCAGATGG + Intergenic
1089606492 11:119644431-119644453 TGCACCCCAGGCTTCCCTCAGGG + Intronic
1093034110 12:14316880-14316902 TTCACCCCATGGGTCCCAGATGG - Intergenic
1096874156 12:54614231-54614253 TGCATCCCAGGCCTACCAAATGG - Intergenic
1096978939 12:55717378-55717400 TGCTCCCCAGGCTTGCCAGAGGG - Intronic
1097463247 12:59889840-59889862 TGCAAACCATGCATCCCAGAAGG - Intergenic
1101613983 12:106318379-106318401 TGAATCCAAGACGTCCCAGAAGG - Exonic
1103776846 12:123372224-123372246 GGCACCCCCCGCCTCCCAGACGG - Intergenic
1103847023 12:123908757-123908779 GGGACCCCAGGCTTCCCAGGCGG + Intronic
1104987016 12:132603021-132603043 GCCTCCCCAGGCTTCCCAGAAGG + Intergenic
1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106186269 13:27412584-27412606 TGCACCCCAGGGCACCCAGAAGG + Intergenic
1113242807 13:108358557-108358579 TACAACCCAGTTGTCCCAGATGG - Intergenic
1113452647 13:110422556-110422578 TGCCCTCCACGTGTCCCAGAGGG - Intronic
1113556078 13:111236160-111236182 TGCACCACAGGAGTCCCAGAAGG - Intronic
1113584824 13:111458021-111458043 TGCACCCCAGGCCACACAGCTGG - Intergenic
1113945494 13:114041831-114041853 GGCTCTCCAGGGGTCCCAGAAGG - Intronic
1114551379 14:23534587-23534609 TGAAACCCAGGCGGCACAGAAGG + Exonic
1122047844 14:99036133-99036155 TGCAGCCCAGACATTCCAGAGGG + Intergenic
1122272400 14:100574082-100574104 TGAACCCCAGGCATCCCCAAGGG + Intronic
1127671278 15:61197456-61197478 TGCACCTCAGGTTTGCCAGATGG + Intronic
1129203277 15:74019045-74019067 TGCACCTCAGTCTTACCAGAGGG + Intronic
1132621472 16:870106-870128 TGCACCCCACTCGGCCCAGCCGG - Intronic
1136927399 16:34388112-34388134 TGCACCCCAGGGTACCCAGAGGG + Intergenic
1136977175 16:35023694-35023716 TGCACCCCAGGGTACCCAGAGGG - Exonic
1137624579 16:49899794-49899816 TGCATCCCAGAGGTTCCAGAGGG - Intergenic
1138924856 16:61579149-61579171 TGCACCCCAGGTGAACCATATGG - Intergenic
1139263924 16:65622239-65622261 TGCACACCAGTCATCCCTGAGGG + Intergenic
1139472648 16:67186496-67186518 TGCTCCCCAGGCAGCCCAAAGGG - Intronic
1141252348 16:82369960-82369982 TGCCACCCAGGAGTCCCAGCTGG - Intergenic
1142380740 16:89730561-89730583 TGCACTCCTGGGGTCCCAGAGGG - Intronic
1142429068 16:90016657-90016679 GGCCCCCCAGGCTTCCCTGAGGG + Intronic
1144738635 17:17568902-17568924 TGCACCCCAGGGTGGCCAGACGG - Intronic
1147265366 17:39231395-39231417 TGCACCCCAGGCCTCCTGGAGGG + Intergenic
1148383288 17:47216364-47216386 TGCATACCAGGCTTCCCAGCAGG + Intronic
1148905652 17:50910219-50910241 TGGCCCCGTGGCGTCCCAGAGGG + Intergenic
1152308996 17:79537855-79537877 TGGACCCCAAGTGTCCCAGGAGG + Intergenic
1153501665 18:5755916-5755938 TGCACCCTAGAAGTCCCAAAGGG - Intergenic
1155864288 18:30945151-30945173 TGCATCCAAAGCATCCCAGAAGG + Intergenic
1157592600 18:48844545-48844567 TGCGGACCAGGCGCCCCAGAGGG - Intronic
1160524660 18:79527897-79527919 TGAACCCCAGGGGTGCCAGAAGG - Intronic
1161571014 19:5030952-5030974 TGCCACCCAGTCCTCCCAGAGGG + Intronic
1163551620 19:17968762-17968784 TGCACCCCAGGCTTCAGGGAAGG + Intronic
1165955477 19:39499454-39499476 TACAGGCCAGGCGTCCCGGAAGG - Exonic
1168292928 19:55365861-55365883 TGCCCCCCAGGCCTCACGGAAGG + Exonic
1168325555 19:55536926-55536948 TGCAGCCCAGGCTCCCCTGAGGG + Intronic
1168694598 19:58397236-58397258 GGCACCGCAGTCGTCCCACAAGG + Intergenic
926608126 2:14917973-14917995 TGCAGCTCAGGCCTCCCAGTGGG + Intergenic
929020674 2:37549569-37549591 TTCACCACAGGGGACCCAGATGG - Intergenic
929057308 2:37889460-37889482 AGCACCCCAGGCCTCCCTGCAGG + Intergenic
934309786 2:91852168-91852190 GGCACCCCTCACGTCCCAGACGG - Intergenic
936869474 2:117117671-117117693 TTTACCACAGGCTTCCCAGATGG - Intergenic
937206154 2:120238513-120238535 TGCACCCCTGGCTTCTCAGGAGG + Intergenic
937275746 2:120682890-120682912 TGCTCCCCAGGCCCCCCTGAGGG + Intergenic
944155319 2:196601539-196601561 TGCAGTCCAGGCAACCCAGATGG - Intergenic
944924068 2:204445314-204445336 TGCATAATAGGCGTCCCAGAAGG + Intergenic
948642709 2:239385667-239385689 GCCACCCCAGGAGCCCCAGAAGG + Intronic
1171091846 20:22292858-22292880 TGCTCCCCGGGAGTCCCAGGAGG + Intergenic
1171240245 20:23561886-23561908 TGCAATACAGGTGTCCCAGAAGG - Intergenic
1172112376 20:32554664-32554686 TGCCTCCCAGGAGGCCCAGAGGG + Intronic
1173848241 20:46201363-46201385 TGCAGCCAAGGCCTCACAGACGG - Intronic
1173984666 20:47251759-47251781 TGCACTCCTTGCTTCCCAGATGG - Intronic
1175704779 20:61168542-61168564 AACACTCCCGGCGTCCCAGATGG - Intergenic
1176113798 20:63422450-63422472 CCCACCACAGGCGTCCCAGGAGG + Intronic
1176229735 20:64026084-64026106 TGCACACCATGCACCCCAGACGG - Intronic
1176952737 21:15065246-15065268 TGCTCTCCGGGTGTCCCAGACGG + Intergenic
1181369213 22:22403499-22403521 TGTGCCCCAGGCATCCCGGAGGG + Intergenic
1183068577 22:35380716-35380738 TGCACCCCAGGCGTCCCAGAAGG - Intronic
1183259866 22:36787751-36787773 TGCATCCCAGGCGGCCCCGCAGG + Intergenic
1184693627 22:46128328-46128350 TCCACCCCTGGGGTCCCAGCTGG - Intergenic
950333140 3:12173144-12173166 TTCACCTCAGGCCACCCAGAAGG + Intronic
950337841 3:12213076-12213098 TGCATCTTAGGAGTCCCAGACGG - Intergenic
950436535 3:12983643-12983665 GTCAGCCCAGGCGTCCCTGAAGG - Intronic
954375746 3:50193397-50193419 TGCACGCCAGGTGTGCCAGGAGG + Exonic
954711009 3:52505117-52505139 GGATCCCCAGGGGTCCCAGAGGG - Exonic
955406991 3:58631742-58631764 TACACTCCAGGATTCCCAGAGGG - Intergenic
956619400 3:71205727-71205749 TGCACCTCCTGCGTTCCAGAGGG - Intronic
958100587 3:89004112-89004134 TGCACAGCAGCAGTCCCAGAAGG + Intergenic
964351166 3:155805425-155805447 TGCACTCCAGGCGTGACAGAGGG + Intronic
968609088 4:1549043-1549065 TGCACTGCAGGCAGCCCAGAGGG + Intergenic
968650851 4:1759737-1759759 TGCACCTCAGCCTTCCCAGCTGG + Intergenic
969904038 4:10376539-10376561 TTCACTCCAGGCCTCCTAGATGG - Intergenic
979702564 4:123685166-123685188 GGCACCCCCCGCCTCCCAGATGG - Intergenic
984635111 4:182101968-182101990 TGCAGCCTAAGCATCCCAGAGGG + Intergenic
990003799 5:50922802-50922824 TGCACTGCAGGCAGCCCAGAGGG - Intergenic
995529177 5:113075338-113075360 TGCATCCCAAGCCTCCCCGATGG + Intronic
1006263527 6:32896154-32896176 TGCATCCCAGCAGTCCCAAAGGG + Intergenic
1007825813 6:44599893-44599915 TGCACCCCTGGCATCCCTGTGGG + Intergenic
1017816855 6:158022340-158022362 ACCACCCCAGGCCTCCCACAAGG - Intronic
1019756861 7:2777016-2777038 TGAACCCCAGTTCTCCCAGATGG - Intronic
1022094452 7:27130228-27130250 GCCACCCCAGGCGTCCCGGCAGG - Exonic
1024245930 7:47470702-47470724 TGCAGCCCAGGCCTCCTAGCCGG + Intronic
1026144775 7:67737255-67737277 AGCACCCCAGGTATCCCATATGG - Intergenic
1035282732 7:157787711-157787733 ACCACCCCAGGGGACCCAGATGG - Intronic
1035363212 7:158327920-158327942 TGCACCCCTGGGGACCCTGATGG - Intronic
1035563887 8:628578-628600 ATCACCCCAGGAGTTCCAGAAGG - Intronic
1038541835 8:28396242-28396264 TGCAACCCAGCCTGCCCAGATGG + Intronic
1039391022 8:37180831-37180853 GGCAGCCCAGGAGCCCCAGAGGG + Intergenic
1039918344 8:41875917-41875939 TGCATCCGAGGCTCCCCAGAGGG + Intronic
1040027114 8:42792029-42792051 AGGACCCCAGGCCTCTCAGAAGG + Intronic
1045249058 8:100467993-100468015 TTCACTCCAGGCCTCCCACATGG + Intergenic
1048420468 8:134273412-134273434 TCCAACCCAGGCAACCCAGAAGG - Intergenic
1048833229 8:138496396-138496418 TTCCCCCCAGGAGTCCCAGATGG - Intronic
1048988949 8:139750183-139750205 TGCTCCCCAGGCTTCTCTGATGG + Intronic
1050610258 9:7344802-7344824 TGCACCCCTGCCCTCCCTGAGGG - Intergenic
1055730549 9:79275955-79275977 TGCATCCCAGAGGTCCCAGCAGG - Intergenic
1061008026 9:127939306-127939328 TGGACTCCAGGCCTCCCTGAGGG + Intergenic
1185836645 X:3350819-3350841 TGCAGCCCAGGAGACCCAGGAGG + Intergenic
1200100532 X:153687632-153687654 TGCAGCCCAGGCTTCCCGGCCGG - Intronic
1201239970 Y:11949232-11949254 TGCAGCCCAGGAGACCCAGGAGG - Intergenic