ID: 1183069544

View in Genome Browser
Species Human (GRCh38)
Location 22:35386705-35386727
Sequence CCACATCTATGTGGCCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183069535_1183069544 17 Left 1183069535 22:35386665-35386687 CCTGCTCACTCTGCTTTCAGCTG 0: 1
1: 0
2: 3
3: 32
4: 326
Right 1183069544 22:35386705-35386727 CCACATCTATGTGGCCCTGGAGG 0: 1
1: 0
2: 3
3: 17
4: 164
1183069534_1183069544 22 Left 1183069534 22:35386660-35386682 CCTGACCTGCTCACTCTGCTTTC 0: 1
1: 0
2: 8
3: 24
4: 348
Right 1183069544 22:35386705-35386727 CCACATCTATGTGGCCCTGGAGG 0: 1
1: 0
2: 3
3: 17
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183069544 Original CRISPR CCACATCTATGTGGCCCTGG AGG Exonic