ID: 1183069737

View in Genome Browser
Species Human (GRCh38)
Location 22:35387740-35387762
Sequence CTCTATGACATCTGGTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 85}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183069737_1183069751 20 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069751 22:35387783-35387805 CTGGAGGTGCCATGGGGCCTGGG 0: 1
1: 0
2: 3
3: 36
4: 375
1183069737_1183069755 28 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069755 22:35387791-35387813 GCCATGGGGCCTGGGGCTCGGGG No data
1183069737_1183069754 27 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069754 22:35387790-35387812 TGCCATGGGGCCTGGGGCTCGGG 0: 1
1: 0
2: 3
3: 55
4: 534
1183069737_1183069744 13 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069744 22:35387776-35387798 CCACCCCCTGGAGGTGCCATGGG No data
1183069737_1183069753 26 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069753 22:35387789-35387811 GTGCCATGGGGCCTGGGGCTCGG 0: 1
1: 1
2: 4
3: 59
4: 538
1183069737_1183069750 19 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069750 22:35387782-35387804 CCTGGAGGTGCCATGGGGCCTGG 0: 1
1: 0
2: 3
3: 45
4: 484
1183069737_1183069745 14 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069745 22:35387777-35387799 CACCCCCTGGAGGTGCCATGGGG 0: 1
1: 0
2: 2
3: 20
4: 239
1183069737_1183069742 12 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069742 22:35387775-35387797 GCCACCCCCTGGAGGTGCCATGG 0: 1
1: 0
2: 2
3: 19
4: 253
1183069737_1183069740 1 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069740 22:35387764-35387786 CTTCTCTCTCTGCCACCCCCTGG 0: 1
1: 0
2: 7
3: 85
4: 673
1183069737_1183069752 21 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069752 22:35387784-35387806 TGGAGGTGCCATGGGGCCTGGGG 0: 1
1: 0
2: 4
3: 39
4: 443
1183069737_1183069741 4 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069741 22:35387767-35387789 CTCTCTCTGCCACCCCCTGGAGG 0: 1
1: 0
2: 3
3: 52
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183069737 Original CRISPR CTCTATGACATCTGGTTAGA AGG (reversed) Intronic
909067153 1:70948897-70948919 CTTTATGACATCTGTCTAAAGGG - Intronic
911443724 1:97963997-97964019 ATGTTTGACATCTGGTTAGTGGG + Intergenic
918477843 1:184944661-184944683 CTTTATGACAACTGGTTTCATGG - Intronic
918863643 1:189865374-189865396 TTGTAATACATCTGGTTAGAAGG - Intergenic
921949114 1:220910497-220910519 CTCTATGTCATATGAGTAGACGG + Intergenic
1079142544 11:17822040-17822062 GTCTATGGCTTCTGTTTAGAGGG - Intronic
1081262383 11:40976771-40976793 CTCTAGGACATATATTTAGAAGG - Intronic
1082649861 11:55776490-55776512 CTCTCTGGCAGCTGATTAGACGG - Intergenic
1092062858 12:5565094-5565116 CACTGAGACATCTGGTGAGAAGG - Intronic
1096452062 12:51751580-51751602 CTGTAGGAAATCTGGTAAGATGG + Exonic
1096603707 12:52749101-52749123 CTGTAAGACATCTGGGGAGATGG + Intergenic
1097106421 12:56628904-56628926 CTCTATGACCTCTAGCTAAAGGG + Intronic
1099722828 12:86385448-86385470 TTCTCTGACATCTAGTTGGAGGG - Intronic
1100705291 12:97194221-97194243 CTCCATGACTTTTGGTTACAAGG + Intergenic
1101363051 12:104045619-104045641 CTCTTTGGCATCTGGTAAAATGG - Intronic
1101634057 12:106522387-106522409 CCCAATCACATCAGGTTAGAAGG - Intronic
1102763473 12:115410169-115410191 CTCTTTGGCAGCTGATTAGATGG - Intergenic
1110743647 13:79027174-79027196 CTCAATGACATTTGGTTATATGG - Intergenic
1111294743 13:86264044-86264066 CACTTTGACATCTGTTTATATGG + Intergenic
1112184076 13:97111603-97111625 CTAGATGACATCTGCTTAGTTGG + Intergenic
1112189940 13:97166541-97166563 CTCACTGACAGCTGATTAGATGG - Intergenic
1112875772 13:104036680-104036702 CTCAATGGCAGCTGATTAGATGG + Intergenic
1113225107 13:108151321-108151343 TTCTATGTCATCTTGTTAAATGG - Intergenic
1114805933 14:25836741-25836763 CTCTGTGGCATGTGGTTGGAAGG + Intergenic
1115937177 14:38565452-38565474 CTCTGTGAAATCTGGTTGAATGG + Intergenic
1117945726 14:61017890-61017912 CTATATAACATCTGGATAGAAGG - Intronic
1120520421 14:85521129-85521151 GTCTATTACATCTGGGTAGACGG - Intergenic
1122439860 14:101723282-101723304 CTCTCTGGCAGCTGATTAGATGG - Intergenic
1122596468 14:102896524-102896546 CTTTATGACATCTGTTTTCAGGG + Intronic
1128565335 15:68697342-68697364 CTGTATGACAGGTGGGTAGATGG + Intronic
1131767753 15:95699174-95699196 CTCTATCACTTCTGTTTGGAAGG + Intergenic
1134018862 16:10907728-10907750 CCCTATGACAACTGGCTGGAGGG + Exonic
1134812552 16:17180054-17180076 CTCTCAGCCATCTGGTGAGATGG - Intronic
1135124004 16:19791695-19791717 CACTTTGACATCTGTTTATATGG - Intronic
1137387149 16:48052180-48052202 CTCTGTGACAGCTGATGAGAAGG + Intergenic
1139603740 16:68002969-68002991 CTCTGGGACATCTGGGTAGTAGG + Intronic
1146918549 17:36694290-36694312 CTCTATGAATGCTGGCTAGAAGG + Intergenic
1149265098 17:54920028-54920050 GTTTATGACATAGGGTTAGAGGG - Intronic
1149704302 17:58681547-58681569 CACTTTGAAATCTGGTTGGAGGG + Intronic
1152638135 17:81438593-81438615 CTCGATGACACCTGGTGGGAGGG - Intronic
1163195544 19:15717197-15717219 CACTCTGACAGCTGGTTAGATGG + Intergenic
1164854516 19:31510759-31510781 CTCCATGACAGCTGGATAGGAGG + Intergenic
1165238871 19:34447241-34447263 CTCAATGGCAGCTGATTAGATGG + Intronic
931839574 2:66134370-66134392 CTCCATGGCATCTTATTAGAAGG - Intergenic
935120522 2:100180000-100180022 CCCTCTGCCTTCTGGTTAGAGGG + Intergenic
937689851 2:124743148-124743170 CTCTATGAAATCTGGTGAGCAGG - Intronic
937893107 2:126955280-126955302 CTCTATTCCTTCTGGTTTGAGGG - Intergenic
938641103 2:133280936-133280958 GTTTATGACATCTTGTAAGAGGG - Intronic
938696901 2:133842797-133842819 TTATATGACATCTCCTTAGATGG - Intergenic
939253534 2:139714478-139714500 CTCTAAGACATCAGGTGAGATGG - Intergenic
939625302 2:144469548-144469570 GTCTCTGAACTCTGGTTAGAAGG - Intronic
947993444 2:234505862-234505884 CTCGATGGCAGCTGATTAGATGG + Intergenic
1182146141 22:27997941-27997963 TTCTGTGACATCTGGTCACAGGG - Intronic
1183069737 22:35387740-35387762 CTCTATGACATCTGGTTAGAAGG - Intronic
955527318 3:59834638-59834660 CTCTCTGACATCTTCTTATAAGG + Intronic
960373728 3:116872746-116872768 GTCTAAGACATCTGGTGAAAGGG + Intronic
960731363 3:120731262-120731284 CTCCATGGCATCCTGTTAGAGGG + Intronic
961521302 3:127468797-127468819 CTCCAGGACACCTGGTGAGAGGG + Intergenic
962315826 3:134358955-134358977 TTCTGTGGCATCTGCTTAGAAGG + Intronic
963616000 3:147539001-147539023 CTCTCTGGCAGCTGATTAGATGG - Intergenic
969064733 4:4469814-4469836 CTCTATGACAGGTGGAAAGAAGG + Intronic
969446802 4:7249622-7249644 CTCTGTGACATCCTGGTAGATGG + Intronic
969891015 4:10260138-10260160 CTCTAGTAAATCTGGTGAGAAGG + Intergenic
974848440 4:67379725-67379747 CCTTATGACATCTGTTTATATGG - Intergenic
975677789 4:76844290-76844312 CTCACTGACAGCTGATTAGATGG - Intergenic
978211325 4:106139675-106139697 CTCTATGATCTCTGGTTTTAAGG - Intronic
981073630 4:140569643-140569665 CTCTAAGAAATCTAATTAGAAGG - Intergenic
981762043 4:148205359-148205381 CTATAGGACATCTGGTGAAAAGG + Intronic
984138095 4:175966562-175966584 CTCTCTGACCTCTTGTTATAAGG - Intronic
988077509 5:26371872-26371894 CTCTATGACATTTGGACAGATGG + Intergenic
993887457 5:93432586-93432608 CTCTCTGAGATATGGTAAGAAGG - Intergenic
994611332 5:102045095-102045117 CTCTGTGCCTTCTGATTAGATGG + Intergenic
995304291 5:110626125-110626147 CTCTATTATATTTGGTAAGAGGG + Intronic
997493639 5:134301429-134301451 CTCTATAATATTTGGATAGAGGG - Intronic
1004433661 6:15569119-15569141 CTATATGACTTTTGGTTACAAGG - Intronic
1005684887 6:28244790-28244812 CTTTAGGACATCTGGTTGGATGG - Exonic
1017701522 6:157077580-157077602 CTCTAGGACAGCTGGTGGGAAGG - Intronic
1021648386 7:22808645-22808667 CTAAATGTCATCTTGTTAGAGGG - Intergenic
1026060090 7:67018227-67018249 CTCGTTGGCTTCTGGTTAGAAGG + Intronic
1026718026 7:72806960-72806982 CTCGTTGGCTTCTGGTTAGAAGG - Intronic
1028086943 7:86647120-86647142 CTCTATGACAGGTGATTAGCTGG + Intronic
1031422035 7:121564381-121564403 ACCTAGGACATCTGATTAGAGGG + Intergenic
1033637334 7:143224150-143224172 CTCTAAGATATCTGGGGAGAGGG - Intergenic
1034015220 7:147576123-147576145 CTCTATGATTTCTGGTTAACTGG + Intronic
1034540012 7:151751846-151751868 CTCTAATACATCTGCTGAGAAGG + Intronic
1034830438 7:154303747-154303769 CTCTAAGAAGTCTGGGTAGATGG - Intronic
1035974320 8:4290344-4290366 CTCTATGACATCTGAATGGAGGG + Intronic
1039494734 8:37972389-37972411 CTCTCTGCCTTCTGGTTAGATGG - Intergenic
1045067530 8:98463106-98463128 TTCTATGTCCTCTGCTTAGAAGG - Intronic
1049716793 8:144096712-144096734 CTCTAAGACATCTGTGTAGATGG - Exonic
1056295024 9:85184222-85184244 CTGTAAGACATCTGGAGAGAGGG - Intergenic
1061318173 9:129810528-129810550 CTCTATGATATATGGTTGGGGGG - Exonic
1203783410 EBV:113964-113986 CGTTATCACATCTGGTTAGCAGG + Intergenic
1189355320 X:40306070-40306092 CTCTATGCCAGCTGGTGAGGCGG + Intergenic
1192082256 X:68059789-68059811 CTTTATGACATATGGGTTGAGGG - Intronic
1194441173 X:93936421-93936443 CTCTCTGAGAACTGGTGAGAGGG + Intergenic
1199514375 X:148659446-148659468 CTCTATGACACCTAGGGAGAAGG + Intronic