ID: 1183069738

View in Genome Browser
Species Human (GRCh38)
Location 22:35387748-35387770
Sequence AGAGAAGGCTCTATGACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183069738_1183069741 -4 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069741 22:35387767-35387789 CTCTCTCTGCCACCCCCTGGAGG 0: 1
1: 0
2: 3
3: 52
4: 441
1183069738_1183069751 12 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069751 22:35387783-35387805 CTGGAGGTGCCATGGGGCCTGGG 0: 1
1: 0
2: 3
3: 36
4: 375
1183069738_1183069745 6 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069745 22:35387777-35387799 CACCCCCTGGAGGTGCCATGGGG 0: 1
1: 0
2: 2
3: 20
4: 239
1183069738_1183069755 20 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069755 22:35387791-35387813 GCCATGGGGCCTGGGGCTCGGGG No data
1183069738_1183069740 -7 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069740 22:35387764-35387786 CTTCTCTCTCTGCCACCCCCTGG 0: 1
1: 0
2: 7
3: 85
4: 673
1183069738_1183069744 5 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069744 22:35387776-35387798 CCACCCCCTGGAGGTGCCATGGG No data
1183069738_1183069753 18 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069753 22:35387789-35387811 GTGCCATGGGGCCTGGGGCTCGG 0: 1
1: 1
2: 4
3: 59
4: 538
1183069738_1183069752 13 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069752 22:35387784-35387806 TGGAGGTGCCATGGGGCCTGGGG 0: 1
1: 0
2: 4
3: 39
4: 443
1183069738_1183069750 11 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069750 22:35387782-35387804 CCTGGAGGTGCCATGGGGCCTGG 0: 1
1: 0
2: 3
3: 45
4: 484
1183069738_1183069754 19 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069754 22:35387790-35387812 TGCCATGGGGCCTGGGGCTCGGG 0: 1
1: 0
2: 3
3: 55
4: 534
1183069738_1183069742 4 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069742 22:35387775-35387797 GCCACCCCCTGGAGGTGCCATGG 0: 1
1: 0
2: 2
3: 19
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183069738 Original CRISPR AGAGAAGGCTCTATGACATC TGG (reversed) Intronic
900651372 1:3731611-3731633 AGAGAAGGCTCTTTGCCCTCCGG - Intronic
902163577 1:14551907-14551929 AGAGAAGAGTACATGACATCAGG - Intergenic
906395351 1:45458814-45458836 ATAGAAGGCTCCATCCCATCTGG + Intronic
909331303 1:74415009-74415031 CTAGAAGGCCCTATGTCATCTGG + Intronic
910960133 1:92752991-92753013 AGAGAAGGATACATGACATGAGG + Intronic
911086593 1:93983394-93983416 AGAGAAGGGAATATGACATGAGG + Intergenic
913587415 1:120289366-120289388 AGAGGAGGCTCTATGATACATGG + Intergenic
913620770 1:120609003-120609025 AGAGGAGGCTCTATGATACATGG - Intergenic
914569430 1:148901250-148901272 AGAGGAGGCTCTATGATACATGG + Intronic
914603396 1:149229006-149229028 AGAGGAGGCTCTATGATACATGG - Intergenic
916317504 1:163466362-163466384 AGAGAAAGTTGTATGATATCTGG - Intergenic
924209569 1:241750464-241750486 AGAGAAGAGTATATTACATCAGG - Intronic
1062893772 10:1087136-1087158 AGAGAAGACACTGTGACAGCAGG - Intronic
1063537868 10:6902764-6902786 AGAGAAGACTCTAGGATATAGGG + Intergenic
1067010177 10:42703793-42703815 AGGGTAGGCTATATGACACCTGG + Intergenic
1067201371 10:44174911-44174933 AGAGAAGTCTCCAAGACAACTGG - Intergenic
1067313582 10:45139843-45139865 AGGGTAGGCTATATGACACCTGG - Intergenic
1073622854 10:105066837-105066859 AGAGAAGGCTCAATGATTCCTGG - Intronic
1074422653 10:113323082-113323104 AGTGAAGGCCCTATGACATGAGG - Intergenic
1077468304 11:2744296-2744318 AGAGAAGGCTCTTAGCCAGCTGG + Intronic
1078318400 11:10310674-10310696 AGAGAGAGCGCTATGACATAAGG + Intronic
1081059275 11:38452771-38452793 AGAGAAAATTCTATGACTTCTGG + Intergenic
1084003817 11:66313090-66313112 AGAGCCGGCTCTTTGTCATCTGG - Intergenic
1087969518 11:104462058-104462080 AGAGATGGCCCTCTGACATGTGG - Intergenic
1088086488 11:105987009-105987031 AGAGAAGGATCTGTGAAGTCAGG - Intergenic
1091840224 12:3615302-3615324 AGGGCAGGCTCTGTGACCTCAGG + Intronic
1093190606 12:16070258-16070280 TGAGAAGGATTTATGACTTCAGG + Intergenic
1098384716 12:69906798-69906820 AGGGAAGGCTATCTGTCATCTGG - Intronic
1098784401 12:74732142-74732164 AGCGCAAGCTCTATGAGATCAGG - Intergenic
1101740017 12:107493453-107493475 AGAGAAGGTTCTAACACATGGGG - Intronic
1106467326 13:30024536-30024558 TGAAAAGGCTCAATGACATCAGG - Intergenic
1107660938 13:42638460-42638482 AGACAAGGCTCTAATACATTGGG + Intergenic
1112191247 13:97179891-97179913 ACAAAAGGCCCTGTGACATCTGG - Intergenic
1112914383 13:104528656-104528678 AGAGAAGGCTCTGAAAAATCAGG - Intergenic
1113386786 13:109856357-109856379 AGAGATGGCTCTATGTCATAGGG + Intergenic
1115654693 14:35432050-35432072 AGAAGATTCTCTATGACATCTGG - Intergenic
1116564203 14:46424589-46424611 AGAGAAGGCTCGAGGACAGAGGG + Intergenic
1118805926 14:69236909-69236931 AGAGCAGGCTTCAGGACATCTGG - Intronic
1118895570 14:69942950-69942972 GGAGAAGGCTCTCTTACACCAGG - Intronic
1119339162 14:73861358-73861380 AGAAAAGACTGTATGACCTCTGG - Intronic
1119939712 14:78627346-78627368 AGTGTAGCCTCTATGACTTCAGG - Intronic
1121865977 14:97363196-97363218 AGAGAAGGCTCTTTCAGATGTGG - Intergenic
1122401312 14:101469176-101469198 AGAGAAGACTCTTGGACACCTGG - Intergenic
1123692640 15:22851849-22851871 AGGAAAGGCTCTATGAGAGCAGG + Exonic
1123804317 15:23855332-23855354 AGTGAAGGCTCTGTGACCACAGG + Intergenic
1128099173 15:64984194-64984216 AGAAAAGGCTGTCTCACATCTGG - Intronic
1130443933 15:83981206-83981228 AGAGAAGGCTCAATGTGTTCTGG - Intronic
1132002553 15:98194516-98194538 ATAGTAGGCTCCCTGACATCAGG - Intergenic
1132155499 15:99492848-99492870 AGTGAAGGCAAAATGACATCAGG - Intergenic
1132298142 15:100759289-100759311 AGAGGAGGCTATAGCACATCAGG - Intergenic
1134018858 16:10907720-10907742 AGAAGAGGCCCTATGACAACTGG + Exonic
1138214034 16:55187360-55187382 AGAGAAGGCTCTATCAAAATTGG - Intergenic
1141910691 16:87056692-87056714 AGAGGAGGCTCTATTGCAGCGGG - Intergenic
1143480436 17:7224853-7224875 AGAAAATGCTCTGTGACACCTGG + Exonic
1145404314 17:22571766-22571788 AGAGAAGGCTTTGTGAAATGAGG + Intergenic
1145906380 17:28518421-28518443 AGAGAAGGCTCTCTGAGAGGTGG + Intronic
1147033086 17:37657214-37657236 ATAAAAGGCTCTATAACATAAGG + Intergenic
1147062228 17:37889680-37889702 AGAAAAGGCTATATGATATAGGG - Intergenic
1149452772 17:56762835-56762857 AGAGAAGCCTCAGTGAGATCTGG - Intergenic
1149943550 17:60897572-60897594 AGCGAAGACATTATGACATCTGG - Intronic
1150041312 17:61863978-61864000 TAAGAAGGCTCTGTGACATCGGG + Intergenic
1155227318 18:23740309-23740331 AGAGAAGGATTGATGACATATGG - Intronic
1156390972 18:36650384-36650406 AGAGAAGATTCTATGACCCCCGG - Intronic
1159878187 18:73833347-73833369 TGAGAAGGCTCTTTGGCATTTGG - Intergenic
1163037740 19:14580862-14580884 TGGGAAGGCTCTATGACATCAGG + Intergenic
1165286195 19:34844418-34844440 AGAGAAGGCTTGCTGACATGCGG + Intergenic
1166594825 19:44036268-44036290 AGAGAAGCTTATATGACAGCTGG - Intergenic
1166647296 19:44541690-44541712 AGTGTAAGCTCTAGGACATCAGG - Intergenic
1168639599 19:58021923-58021945 AGATAAAGTTCTATGAAATCGGG + Intergenic
925301993 2:2823444-2823466 AAAGAAGGCTGTCTGACTTCTGG - Intergenic
926658565 2:15438316-15438338 AGAATAGGCTCCATGACAACAGG + Intronic
927849721 2:26491267-26491289 AGAGCAGTGTCAATGACATCTGG + Intronic
928338196 2:30417066-30417088 AGAGAAGGCTCCTTGAAACCAGG + Intergenic
929355616 2:41020520-41020542 AAAGAAGGGTCTGTCACATCAGG + Intergenic
930468325 2:51781199-51781221 AGAGAAGGCTTTCTGGCATTTGG + Intergenic
930732932 2:54745335-54745357 ATAGAAGGCACTATCCCATCTGG - Intronic
930740737 2:54830463-54830485 AGAGAAGACCCTGTGACATAGGG + Intronic
933112273 2:78418111-78418133 AGAGAAGGCACAATAACAGCTGG - Intergenic
933837833 2:86260146-86260168 AGACTAGGATCTATGACACCTGG + Intronic
938811333 2:134855630-134855652 AGAGCTGGGTCTCTGACATCAGG - Intronic
940239720 2:151549756-151549778 AGAGCAGGTTAAATGACATCGGG + Intronic
941760572 2:169237994-169238016 AGAGAAGGCCCTACCTCATCTGG - Intronic
943458897 2:188144396-188144418 AGAGAAGGCACTATAATGTCTGG + Intergenic
943955540 2:194184621-194184643 AGTAAAAGCTCTATGCCATCAGG + Intergenic
945781750 2:214183408-214183430 TGTGAAGGCTCAATGACATCAGG + Intronic
948758312 2:240172383-240172405 TGAGAAGGCTCTATGCCAGAAGG - Intergenic
1170069504 20:12350144-12350166 TCAGAAGGCTCTAGAACATCCGG + Intergenic
1171562450 20:26137264-26137286 AGAGAAGGCTTTGAGAAATCAGG + Intergenic
1173673181 20:44811673-44811695 TGAGAAGGTTGTTTGACATCTGG - Intergenic
1174222854 20:48971274-48971296 AGAGAGAGCTCAAAGACATCAGG - Exonic
1175412296 20:58778250-58778272 AGAGAAGGTTCTATGAAGGCAGG + Intergenic
1175632371 20:60552547-60552569 AGTGAAGGCTCTATGTCAGGAGG + Intergenic
1178025918 21:28466633-28466655 AGAGAAGGATATATGACCTTAGG + Intergenic
1182042262 22:27247474-27247496 AGAGAGGGCTCTGTGACAAGTGG + Intergenic
1183069738 22:35387748-35387770 AGAGAAGGCTCTATGACATCTGG - Intronic
1183548821 22:38469310-38469332 AGAAAAGGCCCTTTCACATCTGG - Intronic
949448071 3:4156401-4156423 AATGAAGGCTCTATGAGAGCAGG + Intronic
950105462 3:10385650-10385672 AGAGAGGGCTCCATGAAATGAGG + Intronic
950841041 3:15968735-15968757 ACAGAAGTCTCTAGGATATCAGG - Intergenic
954440762 3:50520870-50520892 AGGAAAGGCTCTCTGGCATCTGG - Intergenic
958611645 3:96434131-96434153 AAGGTAGTCTCTATGACATCAGG + Intergenic
959394736 3:105823302-105823324 AGAGAAGCATCTATGAGATTAGG - Intronic
960244246 3:115381764-115381786 AGAGAATGCTCTCTGAGATAAGG - Intergenic
961360794 3:126365943-126365965 AGAGAAGGCTTTAAGACCCCAGG + Intergenic
962156292 3:132952271-132952293 AGAGGAGGCTCTCTGACTCCTGG - Intergenic
964740274 3:159957961-159957983 AGAGAAAGCTGGATGCCATCTGG - Intergenic
965586432 3:170322750-170322772 AGAGAAAGCACTGTTACATCGGG + Intergenic
965709370 3:171541891-171541913 AGTGAGGGCTCCATGACATTTGG - Intergenic
967096279 3:186180033-186180055 ACAGAAGGGATTATGACATCTGG + Intronic
967395104 3:188999288-188999310 AGAGAAGTCTCCTTGACTTCTGG + Intronic
967552376 3:190811668-190811690 ACAGATGGCACTGTGACATCAGG - Intergenic
970583693 4:17495326-17495348 AGAAGAGGCTCCATGACATGGGG - Intronic
971562505 4:28099417-28099439 AGAGAAACCTCTATAACATAAGG - Intergenic
975634878 4:76438202-76438224 AAAGATGGCTCTATGATGTCAGG + Intronic
976993278 4:91397025-91397047 AGAGAAGCATCTTTGATATCTGG + Intronic
977305884 4:95323288-95323310 AGAGAAAGCTCCATGAAATCCGG - Intronic
979505267 4:121487768-121487790 AGAGAAGGATAAATGAGATCAGG + Intergenic
979952464 4:126910121-126910143 AGAAAAAGATCTGTGACATCAGG + Intergenic
981308999 4:143277725-143277747 AGAGAAGGATCTAGGAAAGCAGG - Intergenic
982713935 4:158787030-158787052 ACAGAAGGATCCATGACTTCAGG + Intronic
983519687 4:168694857-168694879 AGAGAAGGTACTATGACAAACGG - Intronic
985524129 5:393286-393308 AGACAAGAATCTGTGACATCGGG - Intronic
986802270 5:11274054-11274076 AGAGAAGTCTTTATGAGAGCAGG - Intronic
990345887 5:54870998-54871020 AGAAAAGGCTTGATGACCTCAGG + Intergenic
991345522 5:65662245-65662267 AGAGAAGGCTGTATGTCAAGAGG - Intronic
994000715 5:94775577-94775599 AGAGAATGCTCTATAACAAAGGG + Intronic
994108251 5:95970359-95970381 AGAGGAGGCTCTGTGTCATTTGG + Intergenic
998636643 5:143962606-143962628 AGAGACGGCTTTAAGACTTCTGG - Intergenic
1000505850 5:162116748-162116770 AGAGAAGACTCCATGAGATCTGG - Intronic
1000996647 5:167966085-167966107 AGAGAAGGGTCTCTTGCATCTGG - Intronic
1002547817 5:179962886-179962908 AGAGCAGGCTCCATGACGGCAGG - Intronic
1004227499 6:13799602-13799624 AGAAAAGGCTCTATGTAAACTGG - Intronic
1005856559 6:29867311-29867333 AGAGAAGGCTCTAGGAGCTAAGG + Intergenic
1006800719 6:36758014-36758036 AGAGCAGGCTCTAGGACACTGGG + Intronic
1008413753 6:51215009-51215031 AGAGAATGCTCTTTGACGACTGG + Intergenic
1011444760 6:87426410-87426432 AAAGTAGGCTCAATGACAGCAGG - Intronic
1014702830 6:124711490-124711512 AGAGAAGACTCCAAGACATATGG - Intronic
1015154663 6:130079339-130079361 TGAGAAGGCTCTATGACTAGAGG - Intronic
1022588116 7:31635015-31635037 AGGGAAGGCAATATGGCATCTGG - Intronic
1024448844 7:49515010-49515032 AGAGAGGGCTTTATGACCTTAGG - Intergenic
1024913941 7:54477440-54477462 TGAGAAAGCTCTATGAAGTCAGG + Intergenic
1025275407 7:57578452-57578474 AGAGAAGGCTTTATGAAATGAGG - Intergenic
1026557130 7:71418288-71418310 AGAGAGGGTTCTATGCCACCCGG - Intronic
1026576835 7:71578909-71578931 ACAGAAGGCTTTGGGACATCAGG - Intronic
1027111118 7:75440635-75440657 AAAGAAGGCTCTAAGTCTTCCGG - Intronic
1027283359 7:76625203-76625225 AAAGAAGGCTCTAAGTCTTCTGG - Intronic
1027840009 7:83297618-83297640 AATGAAAACTCTATGACATCTGG + Intergenic
1030069311 7:105685264-105685286 AGCGAAGAGTCAATGACATCAGG + Intronic
1033445774 7:141420673-141420695 GGAGAAGGCTCTGTTACCTCAGG + Intronic
1035206730 7:157298524-157298546 GGAGGAGGCTCTGTGACAACAGG + Intergenic
1035706994 8:1683434-1683456 ACAGAAGGCTCTGTGAGGTCAGG - Intronic
1036694245 8:10964357-10964379 AAAGAAGGCTCCATGTCATCAGG - Intronic
1037204402 8:16296874-16296896 AGAGAAAGCTCCAAGACTTCTGG + Intronic
1038621667 8:29149381-29149403 AGAAAAGTCAGTATGACATCTGG + Intronic
1040821282 8:51560694-51560716 AGAGAAAGCTCCATGACCTTGGG + Intronic
1040981386 8:53249826-53249848 TGAGAAGTCTCTATGAAATAAGG - Intronic
1041320393 8:56606503-56606525 ACAGAAGCCTCTATGCCACCTGG + Intergenic
1041766886 8:61428073-61428095 AGATAAAGCTCTATGACAAAGGG + Intronic
1041860975 8:62511863-62511885 AGACAAGGCTCCATGAAGTCAGG - Intronic
1042655952 8:71096779-71096801 AGAGAAGGGTCTGTAACATTTGG + Intergenic
1043155467 8:76773054-76773076 AGAGAAGGCTTTGCGTCATCTGG + Intronic
1045837110 8:106535418-106535440 AGAGAAGACTCTTTTACATTAGG - Intronic
1046969168 8:120202243-120202265 AGAGAAGTCTAAATCACATCTGG - Intronic
1052446103 9:28563387-28563409 ATAGAAAGCTGTATGACTTCTGG - Intronic
1054713541 9:68535470-68535492 AGAGGAGGCTCCATCCCATCTGG + Intergenic
1056059385 9:82868462-82868484 AGGGAATGCTTTATGACATTGGG + Intergenic
1191235260 X:58128952-58128974 AGAGATGGCTGTGTGACCTCAGG + Intergenic
1191241388 X:58192730-58192752 AGAGAAACCTGTGTGACATCAGG + Intergenic
1191243546 X:58208093-58208115 AGAGACACCTGTATGACATCAGG + Intergenic
1191984396 X:66963587-66963609 AGATAAGGTTCTTTCACATCTGG + Intergenic
1196023607 X:111016305-111016327 AGAGGAGACTCTATGGCAGCAGG + Intronic
1198434735 X:136605753-136605775 AGAGAACGCTGAATGACATGAGG + Intergenic