ID: 1183069739

View in Genome Browser
Species Human (GRCh38)
Location 22:35387763-35387785
Sequence CAGGGGGTGGCAGAGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1707
Summary {0: 1, 1: 0, 2: 13, 3: 162, 4: 1531}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183069739_1183069750 -4 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG 0: 1
1: 0
2: 13
3: 162
4: 1531
Right 1183069750 22:35387782-35387804 CCTGGAGGTGCCATGGGGCCTGG 0: 1
1: 0
2: 3
3: 45
4: 484
1183069739_1183069745 -9 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG 0: 1
1: 0
2: 13
3: 162
4: 1531
Right 1183069745 22:35387777-35387799 CACCCCCTGGAGGTGCCATGGGG 0: 1
1: 0
2: 2
3: 20
4: 239
1183069739_1183069751 -3 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG 0: 1
1: 0
2: 13
3: 162
4: 1531
Right 1183069751 22:35387783-35387805 CTGGAGGTGCCATGGGGCCTGGG 0: 1
1: 0
2: 3
3: 36
4: 375
1183069739_1183069753 3 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG 0: 1
1: 0
2: 13
3: 162
4: 1531
Right 1183069753 22:35387789-35387811 GTGCCATGGGGCCTGGGGCTCGG 0: 1
1: 1
2: 4
3: 59
4: 538
1183069739_1183069758 19 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG 0: 1
1: 0
2: 13
3: 162
4: 1531
Right 1183069758 22:35387805-35387827 GGCTCGGGGTCATGCCCTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 134
1183069739_1183069754 4 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG 0: 1
1: 0
2: 13
3: 162
4: 1531
Right 1183069754 22:35387790-35387812 TGCCATGGGGCCTGGGGCTCGGG 0: 1
1: 0
2: 3
3: 55
4: 534
1183069739_1183069752 -2 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG 0: 1
1: 0
2: 13
3: 162
4: 1531
Right 1183069752 22:35387784-35387806 TGGAGGTGCCATGGGGCCTGGGG 0: 1
1: 0
2: 4
3: 39
4: 443
1183069739_1183069755 5 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG 0: 1
1: 0
2: 13
3: 162
4: 1531
Right 1183069755 22:35387791-35387813 GCCATGGGGCCTGGGGCTCGGGG No data
1183069739_1183069744 -10 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG 0: 1
1: 0
2: 13
3: 162
4: 1531
Right 1183069744 22:35387776-35387798 CCACCCCCTGGAGGTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183069739 Original CRISPR CAGGGGGTGGCAGAGAGAGA AGG (reversed) Intronic
900173842 1:1283386-1283408 CAGGAGCTGGCAGAGAAAGATGG + Intronic
900236726 1:1596282-1596304 CAGAGAGAGGCAGACAGAGACGG + Intergenic
900236739 1:1596462-1596484 CAGAGTGAGGCAGAGAGAGATGG + Intergenic
900236742 1:1596514-1596536 CAGAGAGAGGCAGAGAGAGATGG + Intergenic
900253372 1:1683513-1683535 CAGGGGGTGGCGCCCAGAGAGGG - Intronic
900501284 1:3005942-3005964 CAGGGGAGGGGAGTGAGAGAAGG + Intergenic
900672885 1:3866725-3866747 CAGGGGCTGGCGGAGGGGGAAGG - Intronic
900693128 1:3993787-3993809 CAGGCGGTGGCGGGGAGGGAAGG + Intergenic
900847071 1:5112489-5112511 GAGGGAGAGGCAGAGGGAGAGGG + Intergenic
900862158 1:5241508-5241530 CAGTGGGTGGGAGTGGGAGAAGG - Intergenic
900882900 1:5394651-5394673 GAGGGAGAGGAAGAGAGAGAGGG + Intergenic
900908633 1:5578402-5578424 CAGTGGGAGGGGGAGAGAGAGGG - Intergenic
901018607 1:6245061-6245083 CAGGGAGGGGAAGAGAGGGAAGG - Intronic
901089943 1:6634517-6634539 CAGGTGGTGGCTGAGACAGCTGG - Exonic
901138117 1:7010709-7010731 CTGGGGGTGGCAGTGAGGGTGGG - Intronic
901628360 1:10636104-10636126 CACAGGGTGGCAGAGCCAGAAGG - Intergenic
901935463 1:12623178-12623200 ATGGGGGTGACAGAGAGAGATGG + Intergenic
901971595 1:12913004-12913026 CAGGGGGAGGCAGAGGGTGTGGG + Intronic
902013572 1:13288736-13288758 CAGGGGGAGGCAGAGGGTGTGGG - Intergenic
902051694 1:13568186-13568208 CAAAGAGAGGCAGAGAGAGAGGG + Intergenic
902676800 1:18014464-18014486 CAGGGGGTGGCAGGGTCTGATGG - Intergenic
902810702 1:18886309-18886331 CAGGGGGTGGCTGACACTGAGGG - Intronic
902963114 1:19978574-19978596 CAGAGAGGGGCAGAGAGGGAGGG - Intronic
903140993 1:21339077-21339099 CAGGTGGTGCCAGACAGGGAGGG + Intronic
903147842 1:21387007-21387029 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
903202043 1:21749351-21749373 AAGGGAGTGGGAGAGAGACAAGG - Intronic
903321778 1:22547698-22547720 GAGAGGGAGGGAGAGAGAGAGGG - Intergenic
903321786 1:22547752-22547774 GAGAGGGGGGAAGAGAGAGATGG - Intergenic
903360541 1:22774231-22774253 CAGGGAGAGGCGGAGTGAGACGG - Intronic
903368373 1:22818703-22818725 CAGGGGAGGGAAGAGAAAGAGGG - Intronic
903380048 1:22890388-22890410 CAGGGGGAGGCAGGGATAGCTGG - Intronic
903458136 1:23503241-23503263 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
903474956 1:23613244-23613266 CAGGTGCTGGAAGAGAGAGTGGG + Intronic
903519242 1:23934957-23934979 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
903681980 1:25103314-25103336 CAGGGAGTGGGAGAGGGAGCTGG + Intergenic
903968789 1:27105963-27105985 CAGGAGGTAGCCCAGAGAGAAGG + Exonic
904043578 1:27597914-27597936 GAGGTGCTGGCAGAGAGAGGAGG - Intronic
904045086 1:27603928-27603950 GAGGGGGAGGGAGGGAGAGAGGG - Intronic
904262482 1:29297650-29297672 CAGTGGGTGCTAGAGAGAGCGGG + Intronic
904273985 1:29368464-29368486 GAGGGAGTGCAAGAGAGAGAAGG + Intergenic
904284294 1:29444080-29444102 GAGGGGGTGGACTAGAGAGATGG - Intergenic
904330697 1:29756119-29756141 CAGTGGGAGACAGAGACAGATGG + Intergenic
904415978 1:30361475-30361497 CAGTGGGAGACAGAGACAGATGG - Intergenic
904571535 1:31469868-31469890 CAGAGGAAGTCAGAGAGAGAGGG - Intergenic
904857512 1:33510189-33510211 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
904857520 1:33510219-33510241 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
904973015 1:34433885-34433907 CTGGGGGTGGCAGACACAGTTGG - Intergenic
905106349 1:35565687-35565709 CAGGGGCGGGCAGAGAGGGAAGG + Exonic
905417474 1:37814081-37814103 CAGAGGGGGGCAGAGATGGAGGG + Exonic
905492424 1:38354936-38354958 CAGAGGAGGCCAGAGAGAGAAGG + Intergenic
905686813 1:39914057-39914079 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
905696785 1:39980554-39980576 CAGGAGGTAGCAGTCAGAGAAGG + Intergenic
905889386 1:41510091-41510113 CAGAGGCTGGCAGAGGGAAAGGG - Exonic
905939808 1:41854115-41854137 CAGAGAGAGGGAGAGAGAGAGGG - Intronic
905939810 1:41854127-41854149 GAGGAGGTGGGACAGAGAGAGGG - Intronic
906105690 1:43290809-43290831 CAGAGCGTGGCAGAGAGAATGGG + Intergenic
906197747 1:43939319-43939341 GAGGGGGAGGGAGGGAGAGAGGG + Intergenic
906684890 1:47756870-47756892 CAGAGAGAGGCAGAGAGAAAGGG - Intergenic
906688792 1:47779275-47779297 CAGGGCCTGGCAGACAGTGACGG + Intronic
906740857 1:48182479-48182501 CAGGATGTGCCAGAGTGAGATGG + Intergenic
906741776 1:48191722-48191744 CAGGGAGAGGGAGAGGGAGAGGG - Intergenic
906762096 1:48384350-48384372 CAGGGAGAGGGAGAGGGAGAGGG + Intronic
906956645 1:50380983-50381005 GAGGGAGAGGCAGAGGGAGAGGG - Intergenic
907045843 1:51299598-51299620 GAGAGTGTTGCAGAGAGAGAGGG + Intronic
907222190 1:52915087-52915109 CAGGGTGTGGGGAAGAGAGATGG + Intronic
907306212 1:53514554-53514576 CGGGGGGAGGCAGGGAGAGCAGG - Intronic
907419940 1:54340468-54340490 CCAGGGGTGGCAGGGAGGGAGGG + Intronic
907494717 1:54836235-54836257 AAGGGGGAGGGAGGGAGAGAGGG - Intronic
907529920 1:55084819-55084841 CAGCAGGCGGCAGAAAGAGAAGG - Intronic
908110375 1:60891146-60891168 CAGAGGGAGAGAGAGAGAGAGGG + Intronic
908391052 1:63683939-63683961 CAGGGAGAGGAAGACAGAGAAGG - Intergenic
908792689 1:67798539-67798561 CTCGGGGTGGCAGAGGGGGATGG - Intronic
909019062 1:70411328-70411350 CCGGGGTTGGGAGAGACAGAAGG - Exonic
909091930 1:71236754-71236776 TAGGGAGTGGCAAAGAGAGTGGG + Intergenic
909253981 1:73394294-73394316 AAGGGGTTTGAAGAGAGAGAAGG - Intergenic
909583090 1:77260101-77260123 CAGGGGGTAGCAGAAAGAAATGG + Intergenic
909878184 1:80837939-80837961 CTGGGGGTAGTAGAGAGAGGAGG - Intergenic
910387415 1:86700560-86700582 CAAGGGCTGGGAGAGAGTGAGGG + Intergenic
910570331 1:88694278-88694300 CAGGGGATGGAGGAGAGGGAAGG - Intronic
910698593 1:90048340-90048362 CAGGGGACGGCAGAGAAAGGAGG + Intergenic
910700582 1:90069854-90069876 AAGGCGGAGGAAGAGAGAGAGGG - Intergenic
910760363 1:90726400-90726422 GATGGGGGTGCAGAGAGAGAGGG + Intergenic
910770996 1:90832535-90832557 TAGGGGGATGCAGAGAGAGAGGG + Intergenic
911073670 1:93851972-93851994 GAGGGGGAGGGAGAGAGGGAGGG + Intergenic
911486868 1:98513635-98513657 GAGGGAGAGGCAGAGGGAGAGGG + Intergenic
911556154 1:99347325-99347347 CAGGGGGTGGGAATGGGAGATGG - Intergenic
911653680 1:100418604-100418626 GAGGTGGAGGCAGAGAGAAATGG + Intronic
911953493 1:104207203-104207225 CAGGGGCTGGGAGAGAGATGGGG + Intergenic
912311504 1:108625956-108625978 CAGGGGATAGCAGCAAGAGAGGG - Intronic
912548050 1:110465470-110465492 CAGGGGGTGTCAGAGAGTCAGGG + Intergenic
912769818 1:112453126-112453148 AAGGGGGTGGGGGAGGGAGAGGG + Intronic
913021330 1:114791508-114791530 CAGGGAGAGGGAGAGGGAGAGGG + Intergenic
913536243 1:119775350-119775372 AGGGGGGTGGCAGTGAGAGGAGG + Intergenic
913997333 1:143662128-143662150 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
914256533 1:145964531-145964553 AAGCGGGTCGCAGAGAGAGATGG - Exonic
914513031 1:148351473-148351495 CAAGAGGTGTCAGAGAGAAAGGG - Intergenic
914513118 1:148351970-148351992 CAGGGGGAGAGAGAGAGAGAGGG + Intergenic
914660984 1:149790662-149790684 CAGGGAGAGAGAGAGAGAGAAGG - Intronic
915447900 1:155984568-155984590 CAGTGGGCAGCAGGGAGAGAGGG + Intronic
915561378 1:156690111-156690133 GAGGGGGGCGCAGAGAGGGAAGG + Intergenic
915598071 1:156906556-156906578 CAGAGGCTGGGAGACAGAGACGG + Intronic
915603684 1:156937955-156937977 CAAGGGGTGTCAGAGAGAGCTGG + Intronic
915713137 1:157920275-157920297 CAGGTGGTGGGAGAGTGGGAAGG - Intergenic
915916076 1:159941761-159941783 CAGGCGGAGGCAGGGAGGGAGGG + Intronic
915940630 1:160116242-160116264 CAGGAGGTGGCAAAGACAGGAGG - Intronic
916087671 1:161282422-161282444 GAGGGGGAGGGAGAGGGAGAAGG + Intronic
916210256 1:162354553-162354575 CACGGGGAGGAGGAGAGAGATGG - Intronic
916263179 1:162862537-162862559 CAGAAGGAGGCAGAGACAGAAGG + Intronic
916560353 1:165929559-165929581 CAGGGGGTGGGATAGAGGGGTGG + Intergenic
916787413 1:168096641-168096663 CAGGGGGTGGCAGACAGCGCTGG + Exonic
917019112 1:170567220-170567242 AAGAGGGAGGCAGAGAGGGAAGG + Intergenic
917027412 1:170659476-170659498 TTGGGGGTGGGAGAGAGAGCTGG - Intergenic
917621097 1:176796843-176796865 AAGGACGTGGGAGAGAGAGAGGG - Intronic
917643677 1:177008473-177008495 GAGGGAGAGGAAGAGAGAGAGGG + Intronic
917643686 1:177008525-177008547 GAGGGAGAGGAAGAGAGAGAGGG + Intronic
917889328 1:179419657-179419679 GAGGGGGAGGGAGACAGAGAGGG + Intronic
918082961 1:181221582-181221604 CTGGGGGAGGCGGAGGGAGATGG + Intergenic
918093150 1:181314570-181314592 CGGGGGGAGAGAGAGAGAGATGG + Intergenic
918147377 1:181769285-181769307 CAGGGTATGGAAGAGAAAGAAGG - Intronic
918221586 1:182440656-182440678 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
918385367 1:184002003-184002025 CAAGGGGTGGCATAGCTAGAGGG - Intronic
918417559 1:184327847-184327869 GAGAGGGAGGAAGAGAGAGAGGG - Intergenic
918741435 1:188136058-188136080 CTGCTGGTGGCAGAGAGTGAAGG + Intergenic
918833974 1:189435514-189435536 GAGGGGGTGGGAGAGGGGGAAGG + Intergenic
919079797 1:192856334-192856356 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
919102246 1:193109007-193109029 AAGGTGGGGGCAGAGGGAGAAGG + Intergenic
919239355 1:194891754-194891776 GAGGCGGGGCCAGAGAGAGATGG + Intergenic
919252523 1:195075551-195075573 CAGGGGAGGGAAGAGAGGGAAGG - Intergenic
919314702 1:195956187-195956209 CCAGGGGTGGCAGAGGCAGAGGG + Intergenic
919464343 1:197912069-197912091 CGGGGTGGGGGAGAGAGAGAAGG + Intronic
920033233 1:203049614-203049636 CAGGGAGGGGCAGAGAGGGAGGG - Intronic
920062624 1:203238134-203238156 AAGGGGGTGAGACAGAGAGAAGG - Intronic
920129584 1:203721453-203721475 GAGGTGGGGGCAGAGAAAGAAGG + Intronic
920189979 1:204187528-204187550 AAGCTGCTGGCAGAGAGAGAAGG + Intergenic
920440961 1:205980073-205980095 CTGGGGGTGGCAGTGAGTGATGG - Intronic
920967023 1:210709367-210709389 CAGGAGGTGGGAGAGAGGCATGG + Intronic
921089372 1:211829475-211829497 CAGAGGGGGACAGAGAGCGAGGG + Intronic
921384188 1:214552376-214552398 CGGGAGGGGGCAGGGAGAGAAGG - Intronic
921944569 1:220877914-220877936 CGGGAGGAGGGAGAGAGAGAGGG + Intergenic
922648230 1:227312857-227312879 GAGTGGGAGGAAGAGAGAGAAGG - Intronic
922947654 1:229530778-229530800 GAGGCAGTGGCATAGAGAGAAGG - Intronic
923161514 1:231318523-231318545 CAGGAGGAGGCAGAGGGAGCAGG + Intergenic
923249006 1:232162142-232162164 GAGAGGGAGACAGAGAGAGAGGG + Intergenic
923264538 1:232301437-232301459 CAGGGCTTGGCAGACACAGAAGG - Intergenic
923666950 1:236006966-236006988 GAGGGGATGGCAGTGAGAGAGGG + Intronic
1062878526 10:960224-960246 CAGGGGTTGACAGAGGGGGAGGG + Intergenic
1063068286 10:2632529-2632551 CAGGGAGTGGCATACAGAAAAGG - Intergenic
1063107107 10:3002032-3002054 GAGTTGGTGGGAGAGAGAGAAGG + Intergenic
1063112317 10:3047794-3047816 GAGGGAGAGACAGAGAGAGAGGG - Intergenic
1063113515 10:3056587-3056609 AAGTGAGAGGCAGAGAGAGATGG - Intergenic
1063157934 10:3397196-3397218 AAGGGGGAGGGAGGGAGAGATGG - Intergenic
1063183694 10:3631142-3631164 GAGAGGGAGGCAGTGAGAGAGGG + Intergenic
1063368986 10:5508620-5508642 CAGGCGCGGGCAGAGAAAGAGGG - Intergenic
1063525214 10:6778700-6778722 GGGGGGGAGGGAGAGAGAGAAGG + Intergenic
1064156558 10:12907744-12907766 CAGGTGGGGGCAGGGAGAAAAGG - Intronic
1064179012 10:13099408-13099430 GAGGGGGAGAGAGAGAGAGAGGG - Intronic
1064413069 10:15125013-15125035 GAGGGGATGGCAGAGGCAGAGGG + Intronic
1065267294 10:23990819-23990841 TAGGGGTTGGCAGCCAGAGAGGG + Intronic
1065515615 10:26521496-26521518 CAGAGAGTGACAAAGAGAGATGG - Intronic
1065718080 10:28593352-28593374 TAGGGGATGGCAGAGGGGGAAGG + Intronic
1065725589 10:28665238-28665260 AAGGAGGTGGGAGAGAGAGGAGG - Intergenic
1065872355 10:29966442-29966464 CAGGTGGAGGGAGAGAGTGAGGG - Intergenic
1065874217 10:29983124-29983146 GAGAGGGTGGAAGAGAGGGAAGG + Intergenic
1065916498 10:30358162-30358184 CTGGGGGAGGCAGGGAGAGCAGG - Intronic
1066263315 10:33750261-33750283 CAGGGTGTGGGAATGAGAGAGGG + Intergenic
1066561244 10:36672139-36672161 GAGGGAGAGACAGAGAGAGAGGG + Intergenic
1067077857 10:43198273-43198295 CAGGAGGCAGCAGACAGAGAAGG + Intronic
1067114240 10:43422625-43422647 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1067768226 10:49105043-49105065 CAGAGGGAGACAGAGAGAGAGGG + Intronic
1067833363 10:49622849-49622871 CAGGTGGTGGCAGAGCAAGGAGG + Intronic
1067920632 10:50453736-50453758 CAGGGAGAGACAGAGGGAGAAGG + Intronic
1068009243 10:51427213-51427235 AAGGGAGAGGCAGAGAGGGAGGG + Intronic
1068406014 10:56589706-56589728 CAGGGAGAGACAGAGAGAAAGGG - Intergenic
1068542380 10:58309647-58309669 CAGCGGGAGTAAGAGAGAGAGGG - Intergenic
1068969403 10:62946958-62946980 CAGGGAGAGGGAGAGGGAGAGGG - Intergenic
1069007812 10:63337461-63337483 GGGGGGGAGGGAGAGAGAGAGGG + Intronic
1069274731 10:66575613-66575635 CAGCTGGTGGGAGACAGAGATGG + Intronic
1069729536 10:70601925-70601947 CAGGGAGTGGCAAAGAGGGGAGG - Intronic
1069856298 10:71442956-71442978 GAGGGCGAGGCAGAGGGAGAGGG + Intronic
1069856446 10:71443579-71443601 ATGGGGGTGGCAGAGAGGGCGGG + Intronic
1069967228 10:72130203-72130225 CAGGGGAGGGCAGAGTGAGAGGG + Intronic
1070050768 10:72887396-72887418 CTGGGGGTGGTGGAGGGAGAAGG - Exonic
1070394894 10:76003369-76003391 GAGAGGATGGTAGAGAGAGAGGG - Intronic
1070637108 10:78137834-78137856 CAGGGGGAGACAGGGAGGGAGGG - Intergenic
1070684335 10:78469720-78469742 CAGGGAGAGGGAGAGGGAGAGGG + Intergenic
1070684343 10:78469743-78469765 CAGGGAGAGGGAGAGGGAGAGGG + Intergenic
1070729629 10:78817447-78817469 AAGGGGATGGGAGGGAGAGAGGG + Intergenic
1070760778 10:79023106-79023128 CAGTGGGTTGCAGACAGAGCTGG - Intergenic
1070823174 10:79375124-79375146 CAAGTGGAGGCAGAGACAGAGGG + Intergenic
1071133270 10:82420968-82420990 CAGGGATTGGCAGTGACAGAAGG + Intronic
1071184768 10:83029032-83029054 CAGGGTGTGGGAGTTAGAGAGGG + Intergenic
1071280337 10:84096018-84096040 CAGAGGGGGAGAGAGAGAGAGGG - Intergenic
1071371069 10:84952399-84952421 CATGGGGTGGTGGAGAGAGGAGG + Intergenic
1071419594 10:85478664-85478686 TAGGGAGGGGAAGAGAGAGAAGG + Intergenic
1071587382 10:86837461-86837483 AAGGGTGTGGGAGAGAGAGCAGG - Intronic
1072673145 10:97446281-97446303 GAGGGGGTGGCAGTGAGCGGCGG + Exonic
1072723532 10:97796552-97796574 CAGGGGTTAGTGGAGAGAGAGGG - Intergenic
1073033711 10:100548357-100548379 AGGCGGGGGGCAGAGAGAGAAGG - Exonic
1073037514 10:100574657-100574679 GAGGAGGAGGCAGAGAGGGAGGG - Intergenic
1073230994 10:101969926-101969948 CGGGATGTGGCAGAGTGAGAGGG + Intronic
1073267201 10:102234881-102234903 CAGAGGGAGGCAGGGTGAGAAGG + Intronic
1073323696 10:102630488-102630510 CAGGGGGTAGGTGAGAAAGAGGG - Exonic
1073446222 10:103582196-103582218 CAGAGGGTGGGAGACAGAGAGGG - Intronic
1073447658 10:103591032-103591054 CAGGTAGTGGGAGAGAGACATGG - Exonic
1073499477 10:103922847-103922869 AAGGGGAAGCCAGAGAGAGAGGG - Intergenic
1073573619 10:104601803-104601825 CAGGGGGTGTCACACAGGGAAGG + Intergenic
1074419395 10:113295540-113295562 TATGGGATGTCAGAGAGAGATGG - Intergenic
1074447513 10:113532848-113532870 CAGGGGTTGGCTGGCAGAGAGGG - Intergenic
1074451188 10:113561126-113561148 CAAGGAGGGGCAGAGAGAGAAGG + Intronic
1074454856 10:113588113-113588135 CAGGGGGTGTCAGGGAGGGATGG - Intronic
1074829148 10:117236459-117236481 CAAAAGATGGCAGAGAGAGAGGG + Intergenic
1075003804 10:118816595-118816617 GAGGGAGAGGGAGAGAGAGAGGG - Intergenic
1075233904 10:120709540-120709562 CAGGGAGAGACAGAGAGGGAAGG - Intergenic
1075557582 10:123444592-123444614 GAGGGGGAGGCTCAGAGAGATGG + Intergenic
1075587039 10:123665851-123665873 TTGGGGGTGGGAGAGACAGACGG + Intergenic
1075667086 10:124239399-124239421 CAGAGGGAGGGAGGGAGAGAAGG + Intergenic
1075912248 10:126134809-126134831 CATGGGAGGGAAGAGAGAGAAGG - Intronic
1076050535 10:127329616-127329638 CTGGGGGAGGCCGCGAGAGAGGG - Intronic
1076383930 10:130044041-130044063 AAGGGAGAGGGAGAGAGAGATGG + Intergenic
1076566812 10:131404525-131404547 CAGGCAGTGGCTGAGAGCGAAGG - Intergenic
1076678100 10:132158447-132158469 GTGGAGGTGGCAGAGAGAGGTGG - Intronic
1077006415 11:359805-359827 CAGAGAGAGGGAGAGAGAGATGG + Intergenic
1077006446 11:359999-360021 CAGAGAGAGGGAGAGAGAGATGG + Intergenic
1077137521 11:1008406-1008428 CATGGGGTGGCAGACAGCCAGGG + Intronic
1077138422 11:1012950-1012972 CAGAGGGTGGCAGCGAGGGCAGG - Exonic
1077209945 11:1365590-1365612 CAGGGGCTGGCAGAGAGGATGGG + Intergenic
1077307030 11:1873060-1873082 GAGGTGGAGGCAGGGAGAGATGG + Intronic
1077712671 11:4552257-4552279 CTGGGGGTGGTAAAGAGAGCTGG - Intergenic
1077745263 11:4896375-4896397 CAGAGGGTGGCAGAGCTGGAGGG - Intronic
1077784187 11:5364937-5364959 CAAGGAGAAGCAGAGAGAGAGGG + Intronic
1078144214 11:8712043-8712065 GAGGCAATGGCAGAGAGAGAGGG + Intronic
1078662090 11:13295892-13295914 CTGGGGGTGGCTGGGTGAGAGGG - Intronic
1078910261 11:15724507-15724529 GAAGGGGTGGCAGAGGAAGAAGG - Intergenic
1079085079 11:17439588-17439610 CAGTGGGAGGGGGAGAGAGACGG - Intronic
1079995754 11:27293562-27293584 GTGGGGGAGGCAGAGAGGGAAGG + Intergenic
1080057681 11:27924511-27924533 GAGGAGGAGGAAGAGAGAGAGGG + Intergenic
1080145768 11:28981666-28981688 CAGTGAGTGAGAGAGAGAGAGGG + Intergenic
1080202474 11:29688819-29688841 AAGGGGAAGGGAGAGAGAGACGG + Intergenic
1080205537 11:29724766-29724788 GAGGTGGAGGGAGAGAGAGATGG + Intergenic
1080411590 11:32029821-32029843 AAGGGGGTGGTAGACACAGAAGG + Intronic
1080903278 11:36515652-36515674 GAGGGGGTGACAAAGAGGGAAGG + Intronic
1081078370 11:38705682-38705704 CAGGGGTTAGAAGAGAGGGAGGG + Intergenic
1081119922 11:39254418-39254440 GAGGGAAAGGCAGAGAGAGAGGG + Intergenic
1081489525 11:43556688-43556710 GAGGGTGGGGGAGAGAGAGAGGG - Intronic
1081660559 11:44885567-44885589 CAGGGGTTGGGGGAGGGAGAGGG - Intronic
1081857961 11:46315931-46315953 CTGGGGGTGCCAGGGAGGGAAGG + Intronic
1082064912 11:47892274-47892296 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1082165840 11:48949626-48949648 CAGGGGAAGCCAGAGAGAAAAGG + Intergenic
1082168869 11:48977736-48977758 CAGGGGAAGCCAGAGAGAAAAGG - Intergenic
1082237369 11:49835363-49835385 CAGGGGAAGCCAGAGAGAAAAGG - Intergenic
1082241330 11:49874370-49874392 CAGGGGAAGCCAGAGAGAAAAGG + Intergenic
1082610749 11:55294309-55294331 CAGGGGAAGCCAGAGAGAAAAGG - Intergenic
1082659185 11:55889365-55889387 CAGGGGAAGCCAGAGAGAAAAGG + Intronic
1082760073 11:57118923-57118945 CAAGGGGAGGGAGGGAGAGAAGG + Intergenic
1082771662 11:57212469-57212491 CATGGGGTGGAACAGAAAGAAGG + Intergenic
1082930312 11:58596288-58596310 CAGGGGGTGACAGAGGTAGAAGG + Intronic
1083120627 11:60509614-60509636 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1083224735 11:61277627-61277649 CAGAGGGTGGCAGTGAGGGCTGG + Intronic
1083310399 11:61780853-61780875 CAGGAAGAGGCAGAGAGGGAGGG - Intronic
1083344189 11:61978106-61978128 CAAGGGGTGGGGGAGGGAGATGG - Intergenic
1083382081 11:62277842-62277864 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1083621788 11:64052946-64052968 CAGGGGTGGGGAAAGAGAGATGG - Intronic
1083684594 11:64368813-64368835 CAGGGGAGGGCGGAGAGAAAAGG + Intronic
1083793192 11:64999181-64999203 GAGGGAGTGGCAGGGAGGGAGGG + Intergenic
1083831858 11:65238599-65238621 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1084428094 11:69096543-69096565 CAGGGGGTGGAAAGCAGAGAAGG - Intergenic
1084642520 11:70434315-70434337 CAGGTGGTGGCTGAGACAGAGGG - Intronic
1084664542 11:70569387-70569409 CCGGGGCTGGCAGAGTGAGCAGG + Intronic
1084690256 11:70721089-70721111 AAGGGAGGGGCACAGAGAGAAGG - Intronic
1084970956 11:72771809-72771831 GAGGGGGAGCCAGACAGAGAAGG + Intronic
1085112244 11:73898212-73898234 AAGGGGGAGGGAGAGGGAGAGGG + Intronic
1085126502 11:74005934-74005956 CTGGGAGGGGCAGAGAGAGTGGG + Intronic
1085266174 11:75239446-75239468 CAGGGGGTAGGGAAGAGAGAGGG + Intergenic
1085288847 11:75382708-75382730 CAGAGGGGAGCAGAGAGACAGGG + Intergenic
1085359463 11:75873439-75873461 CAGTCGGTGGCAGGCAGAGAAGG + Intronic
1085360320 11:75878909-75878931 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
1085480699 11:76820789-76820811 GAGGGAGAGGCAGAGGGAGAGGG - Intergenic
1085481173 11:76824126-76824148 CAGGGCTTGGCCAAGAGAGAAGG - Intergenic
1085618453 11:78019804-78019826 CAGGGTCTGGCACAGAGAGGTGG - Intronic
1087093438 11:94298529-94298551 CATGAGGTGGCAGAGGAAGAGGG + Intergenic
1087214560 11:95481765-95481787 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1087336464 11:96850811-96850833 CAGCAGGAGGTAGAGAGAGAAGG - Intergenic
1087478660 11:98670816-98670838 CAAGGGGAGGCAGAGAGATAAGG - Intergenic
1087487178 11:98770797-98770819 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1087605054 11:100366919-100366941 CAGGGCTTGGGAGAGAGGGACGG - Intergenic
1087974823 11:104531711-104531733 GAGGGAGTGAGAGAGAGAGATGG + Intergenic
1088152589 11:106763334-106763356 GAGTGGGGGGCAGTGAGAGATGG + Intronic
1088209836 11:107442816-107442838 GAGGGGGAGGGAGGGAGAGAGGG + Intronic
1088395379 11:109362231-109362253 CAGGGGTTGGTAGAGAGAGTGGG + Intergenic
1088612357 11:111589981-111590003 CATGGGGTGGAAGAAGGAGAGGG - Intergenic
1088680004 11:112231861-112231883 CAGGCGGAGAGAGAGAGAGAGGG + Intronic
1088718770 11:112573595-112573617 CAGGGGGCAGAAGAGGGAGAGGG - Intergenic
1088728995 11:112664217-112664239 CAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1088840633 11:113624687-113624709 CAGGTGGTGGCGAGGAGAGAGGG + Intergenic
1088853952 11:113729543-113729565 CAGGGAATAGCAGAGAGTGAGGG - Intergenic
1088897809 11:114091393-114091415 CAGGGGGTGGAGGAGAGGAAGGG - Intronic
1088991344 11:114956224-114956246 CAGGGGGTGGAGGTAAGAGAGGG - Intergenic
1089060661 11:115623396-115623418 CAGGGGGTGCCAGGCAGTGAGGG + Intergenic
1089129526 11:116200874-116200896 GAGGGGGTGGGAGTGAGGGAGGG + Intergenic
1089496276 11:118910056-118910078 GAGGGGGTGTCAGAGGGGGAGGG + Exonic
1089597173 11:119587928-119587950 GAGGAGGTGGGGGAGAGAGAGGG - Intergenic
1089747157 11:120625416-120625438 CCGGGGGAGGCGGAGAGAGAAGG + Intronic
1089780765 11:120871796-120871818 GAGAGGGAGGGAGAGAGAGAGGG + Intronic
1089876070 11:121723152-121723174 GAGAGGGTGGCACAGGGAGAGGG + Intergenic
1089914071 11:122135250-122135272 TCAGGGGTGGCAGAGACAGAAGG - Intergenic
1090140039 11:124247701-124247723 CAGAGAGAGGAAGAGAGAGAGGG + Intergenic
1090843896 11:130515249-130515271 CAAGGGGTGGCAGCTGGAGAAGG - Intergenic
1091037082 11:132244074-132244096 CTGGGGCTGACAGGGAGAGACGG + Intronic
1091055517 11:132414804-132414826 CAGTGTGTGCGAGAGAGAGAAGG + Intergenic
1091121301 11:133060194-133060216 GAGGGGGAGGGAGAGGGAGAGGG - Intronic
1091249055 11:134126368-134126390 CAGAGGATGACAAAGAGAGATGG - Intronic
1091471445 12:731650-731672 CAGGTGGTGGCACAGAAAGGTGG + Intergenic
1091754476 12:3042598-3042620 CAGGGGAGGGGAGAGAGTGAAGG - Intergenic
1091797558 12:3305882-3305904 AGTGGGGTGGCAGAGAGAGGGGG + Intergenic
1091820349 12:3471296-3471318 CTGGGGTTTGCAGAGAGAGTAGG - Intronic
1091916377 12:4273882-4273904 GAGGTGAGGGCAGAGAGAGAAGG - Exonic
1091941632 12:4489184-4489206 CAGCGGGAGGATGAGAGAGAGGG + Exonic
1092052621 12:5483085-5483107 GAGGGAGAGGGAGAGAGAGATGG - Intronic
1092137695 12:6161126-6161148 CATGGGGTGGGAGAGAGAGAAGG + Intergenic
1092244628 12:6856638-6856660 GAGGGAGTGGCAGAGAGAGAGGG - Intronic
1092376456 12:7959619-7959641 GTGGGGGTGGCAGATAAAGAGGG - Intergenic
1092859995 12:12712164-12712186 CAGGGCTTGGCAGAGAAAGGAGG - Intergenic
1093055209 12:14549291-14549313 CAGGTGGTAGAGGAGAGAGATGG + Intronic
1093083940 12:14845648-14845670 GAGGGGAGGGGAGAGAGAGAAGG + Intronic
1093181210 12:15968795-15968817 CAGGAGGAGGGAGAAAGAGAAGG - Intronic
1093957410 12:25236646-25236668 AAGGGGGAGGGAGGGAGAGAGGG + Intronic
1094061972 12:26323966-26323988 CAGAGAGAGGCAGACAGAGAAGG + Intergenic
1094103062 12:26784307-26784329 GAGGGAGAGGCAGAGGGAGAGGG - Intronic
1094168220 12:27464337-27464359 CAGGGGCTGGCAGAGTGGGAAGG + Intergenic
1094349615 12:29509387-29509409 AAGGAGGTTGCAGAAAGAGATGG - Intronic
1094494414 12:30980527-30980549 AGTGGGGTGGCAGAGAGAAAGGG - Intronic
1094802570 12:34053720-34053742 CATGGGGGTGCAGAAAGAGAAGG - Intergenic
1095115730 12:38349662-38349684 CATGGGGGTGCAGAAAGAGAAGG - Intergenic
1095402478 12:41830820-41830842 CAGAGGGAGGGAGGGAGAGAGGG + Intergenic
1095774691 12:45999581-45999603 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1095999734 12:48119294-48119316 CAGGTGGAGGCAAAGAGGGAGGG - Intronic
1096070291 12:48771671-48771693 CTGGTGGTGGCAGAGAGTGGGGG - Intronic
1096109386 12:49020159-49020181 CAGGGGGAGCCAGAGGGTGATGG - Exonic
1096180457 12:49547854-49547876 CATGGGGTGCAAGGGAGAGAGGG - Intronic
1096217978 12:49808976-49808998 CAGGGGGAGGGAGAGAAGGAGGG + Intronic
1096241057 12:49960766-49960788 AAGAGGCTGGCAGAGGGAGAGGG + Intergenic
1096490317 12:52009403-52009425 AAGGGGGTGGCAGAGAAAGGAGG + Intronic
1096523793 12:52198841-52198863 CAGAGGGTGGCATGGAGAGTGGG - Intergenic
1096807279 12:54148566-54148588 CAGGGACTGGCAGAGGGAGAGGG - Intergenic
1096838087 12:54363869-54363891 CAGAGGGTGGAAGAGGAAGAGGG + Exonic
1097938467 12:65278797-65278819 GAGGGAGAGGCAGAGCGAGAGGG - Exonic
1098028200 12:66227789-66227811 CAGAGAGAGGGAGAGAGAGAAGG + Intronic
1098379713 12:69854341-69854363 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
1098412412 12:70201102-70201124 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1098545520 12:71707233-71707255 GAGGGGGTGGAAGGGAAAGAAGG - Intergenic
1098846276 12:75539355-75539377 CAGGTGGTGTGAGAGAGACAAGG + Intergenic
1098883547 12:75940998-75941020 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1099240829 12:80136418-80136440 CAGGGGATGGCAGGGAGACCTGG - Intergenic
1099286100 12:80715970-80715992 CAGGGCGGAGCAGAAAGAGAGGG + Intergenic
1100329958 12:93572760-93572782 GAAATGGTGGCAGAGAGAGAAGG - Exonic
1100346698 12:93738567-93738589 CAGGGGGTGGCGGTGGGAGCGGG - Intronic
1100375568 12:94013202-94013224 GAGGGGGAGGGAGGGAGAGAGGG + Intergenic
1100549336 12:95632629-95632651 CATGGGGTGGCAGGGATGGAGGG - Intergenic
1100610973 12:96192349-96192371 CAGGGGTTAGCAGGGAGGGAGGG - Intergenic
1101209723 12:102523853-102523875 GAGGGGGAGGGAGGGAGAGAGGG + Intergenic
1101214349 12:102565605-102565627 CAGGAGATGGCAGAGGGTGAGGG + Intergenic
1102175203 12:110868761-110868783 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
1102186567 12:110951939-110951961 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1102208691 12:111108598-111108620 ATGGAGGTGGCAGAGAGAGAGGG - Intronic
1102223844 12:111213897-111213919 CAGGGGGTGGGGGGAAGAGATGG + Intronic
1102319994 12:111924894-111924916 CAGGGGTTTGGAGAGAAAGAGGG + Intergenic
1102501015 12:113352488-113352510 CAGGGGAGGGGAGGGAGAGAGGG - Intronic
1102561082 12:113762754-113762776 GAGGGAGCGGGAGAGAGAGAGGG - Intergenic
1102598633 12:114012580-114012602 GAGAGGGAGACAGAGAGAGAGGG + Intergenic
1102679947 12:114684575-114684597 AAGGGGGAGGGAGAGAGGGAGGG + Intergenic
1102712612 12:114941407-114941429 GAGAGGGTGCAAGAGAGAGACGG + Intergenic
1102745273 12:115244104-115244126 CAGGGAGAGGAAGGGAGAGAGGG + Intergenic
1102877983 12:116462479-116462501 CAGGGAGAGAAAGAGAGAGAAGG + Intergenic
1102951695 12:117035577-117035599 CAGGGGAAGGCAGGGAGAGCAGG + Intergenic
1102993937 12:117333902-117333924 CAGTTGGTGGCAGAGACAGCCGG + Intronic
1103083789 12:118045852-118045874 CCGGGGGTGGGAGAGGGAGTGGG - Intronic
1103091029 12:118098235-118098257 GAGGGAGAGGCGGAGAGAGAGGG - Intronic
1103091033 12:118098253-118098275 GAGGGAGAGGCGGAGAGAGAGGG - Intronic
1103091037 12:118098271-118098293 GAGGGAGAGGCGGAGAGAGAGGG - Intronic
1103091041 12:118098289-118098311 GAGGGAGAGGCGGAGAGAGAGGG - Intronic
1103091045 12:118098307-118098329 GAGGGAGAGGCGGAGAGAGAGGG - Intronic
1103091049 12:118098325-118098347 GAGGGAGAGGCGGAGAGAGAGGG - Intronic
1103091053 12:118098343-118098365 GAGGGAGAGGCGGAGAGAGAGGG - Intronic
1103091057 12:118098361-118098383 GAGGGAGAGGCGGAGAGAGAGGG - Intronic
1103091061 12:118098379-118098401 GATGGAGAGGCAGAGAGAGAGGG - Intronic
1103150788 12:118636827-118636849 TAGGGATGGGCAGAGAGAGAAGG - Intergenic
1103536094 12:121634728-121634750 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
1103553557 12:121752269-121752291 CAGGTGGGGGCCGGGAGAGAGGG + Intronic
1103562529 12:121800092-121800114 CCGGGGGTGGCTGAGTCAGAAGG + Intronic
1103583327 12:121932862-121932884 GTGGTGATGGCAGAGAGAGAAGG + Intronic
1103591073 12:121992949-121992971 GAGGGAGTGGGAGAGGGAGAGGG - Intronic
1103610560 12:122121671-122121693 CAGGGGCAGGCAGAGAGGGCAGG - Intronic
1103631651 12:122266405-122266427 CAGGGGGTGGTGGAGCAAGATGG - Exonic
1103834485 12:123807980-123808002 GAGGGAGAGGGAGAGAGAGACGG + Intronic
1103933833 12:124464919-124464941 CAGGGTGTGGGAGAGTGAGCCGG + Intronic
1104258978 12:127165709-127165731 CAGAGCGTGGAAGTGAGAGAAGG + Intergenic
1104491940 12:129201770-129201792 TAGGGGGAGAAAGAGAGAGAAGG + Intronic
1104899336 12:132179915-132179937 CAGGTGGTGGGTGACAGAGAAGG - Intergenic
1104938025 12:132376985-132377007 GAGAGGGAGACAGAGAGAGAGGG + Intergenic
1104938077 12:132377395-132377417 CAGAGAGAGACAGAGAGAGAGGG + Intergenic
1104938136 12:132377872-132377894 CAGAGAGAGGGAGAGAGAGAGGG + Intergenic
1104979976 12:132569397-132569419 CAGGGGGTTCCAGAAAGAAAAGG + Intronic
1105305969 13:19169510-19169532 CAGAGAGTGGCAGGGAGAAAGGG - Intergenic
1105451478 13:20503662-20503684 CAGGGGAGTGCAGACAGAGACGG + Intronic
1105575801 13:21650544-21650566 GAGGAGGAGGGAGAGAGAGAGGG - Intergenic
1105812208 13:24005607-24005629 CAGGGGGTGGGAGAGGGATGGGG + Intronic
1105980764 13:25513994-25514016 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
1106148337 13:27072687-27072709 CAGGAGGTAGAAGGGAGAGAGGG + Intronic
1107015166 13:35702387-35702409 GAGGGGGAGGGAGAGAGAGAGGG + Intergenic
1107071217 13:36271754-36271776 AAGGGGGTGGCTGGGAGGGAAGG + Intronic
1107714004 13:43180630-43180652 CAGGGGGTGGCAGTGAGACAGGG - Intergenic
1107819631 13:44274510-44274532 GAGGGAGAGGCAGAGAGAGAGGG + Intergenic
1107863709 13:44683440-44683462 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1107966635 13:45603647-45603669 AAGGGGGTGACAGAGGGAGCAGG - Intronic
1108001920 13:45911637-45911659 GAGGGAGAGACAGAGAGAGAGGG + Intergenic
1108008328 13:45975671-45975693 CAGGGAGCGGGAGAGAGAGAGGG - Exonic
1108334055 13:49421188-49421210 CAGGGGCGGGCAGAGAGGGGAGG - Intronic
1108879177 13:55087918-55087940 CAGGAGGAGGCAGAGCAAGATGG - Intergenic
1108945393 13:56016975-56016997 CAGGGTGAGGCTGAGAGAGGAGG - Intergenic
1110059391 13:71022268-71022290 CAGTGGCTGGCAAAGAGAGAAGG + Intergenic
1110079077 13:71287742-71287764 GGGGAGGTGGCAGAGAAAGATGG - Intergenic
1110171198 13:72502716-72502738 CAGAGGGAGGGAGAGAGGGAGGG + Intergenic
1110355508 13:74562313-74562335 CAGGGAATGAGAGAGAGAGAGGG - Intergenic
1110727640 13:78843743-78843765 CAGGGGGTGGCGGGGACACAAGG - Intergenic
1111230339 13:85337317-85337339 CAGGTGGTGGAAGATGGAGAAGG + Intergenic
1111482063 13:88842531-88842553 CAGGGGGAGGGAGGGAGAGAGGG + Intergenic
1112023336 13:95390951-95390973 CATTGGGTGGCTGAGATAGATGG - Intergenic
1112168070 13:96941261-96941283 CGGGGGGTGGGAGAGAGAGCTGG - Intergenic
1112436818 13:99396464-99396486 CAGGTGAAGGCAGAGACAGAGGG + Intergenic
1112496773 13:99911469-99911491 CAGAGGGAGGCAGAGTCAGAGGG - Intergenic
1112501462 13:99946533-99946555 CAGGGGGAGGCAGAGAGAGCTGG - Intergenic
1112724317 13:102284931-102284953 AAGAGGGAGGGAGAGAGAGACGG - Intronic
1113149192 13:107242978-107243000 AAGTGGGTGGCTGAGAGGGAGGG - Intronic
1113159622 13:107365040-107365062 GAGGGAGAGGGAGAGAGAGAAGG - Intronic
1113405417 13:110034417-110034439 CAAGGGGAGGCAGGGTGAGATGG + Intergenic
1113430662 13:110247827-110247849 GTGTGTGTGGCAGAGAGAGAGGG + Intronic
1113444212 13:110353003-110353025 CAGGGGGCGTCAGTGAGAGCTGG + Intronic
1113577664 13:111405418-111405440 CAGGTGGTGTCAGAGAGAGGAGG + Intergenic
1113695219 13:112341487-112341509 GAGGGAGAGGGAGAGAGAGAAGG - Intergenic
1113695241 13:112341587-112341609 AAGAGGGAGGGAGAGAGAGAGGG - Intergenic
1113758717 13:112832885-112832907 GACGGTGTGGCAGAGACAGAGGG - Exonic
1114273434 14:21119698-21119720 CTTTGGGAGGCAGAGAGAGATGG - Intergenic
1114444181 14:22775613-22775635 GAAGGGATGGCAGAGAGGGAGGG - Intronic
1114458857 14:22874250-22874272 AAGGGGTAGGCAAAGAGAGAGGG + Intronic
1114488559 14:23080496-23080518 CAGGAGGTGTTAGAGAGAGGAGG - Exonic
1114641876 14:24228904-24228926 GAGGGGGAGATAGAGAGAGATGG + Intronic
1114753550 14:25232578-25232600 CAGGGGGAGGGAGAGAGAGAGGG - Intergenic
1115089309 14:29554737-29554759 GGGAGGGAGGCAGAGAGAGAGGG + Intergenic
1115390015 14:32843685-32843707 CAGTTGTTGGCAGAGTGAGAGGG - Intergenic
1115706601 14:36005799-36005821 CAGGGGGTGGGGGAGAGGGGAGG - Intergenic
1115930041 14:38481569-38481591 GAGGGGGAGGCAGAGCAAGATGG + Intergenic
1116186537 14:41606698-41606720 CAGGGGGTTGCGGAGAGGGCCGG - Intergenic
1116231541 14:42224482-42224504 CAGGGGGTGCCAGAGCAACAAGG + Intergenic
1116264599 14:42671495-42671517 GAGAGGGAGGCAGGGAGAGAAGG - Intergenic
1116538343 14:46064553-46064575 CAGGGGTTGGGAGGGAGAGTGGG - Intergenic
1117330638 14:54708520-54708542 CAGAGACTGGCAGAGAGAAAAGG + Intronic
1117497461 14:56319842-56319864 GAGGGAGAGGAAGAGAGAGAGGG - Intergenic
1117586941 14:57217596-57217618 CACGGAGAGGCAGAGAGACAGGG - Intronic
1118318247 14:64738356-64738378 CAGGGTGTGACAGCGAGCGATGG - Intronic
1118416997 14:65550216-65550238 GAAGGGGTGCAAGAGAGAGAAGG + Intronic
1118442522 14:65824868-65824890 TAGAGGGAGGCAGACAGAGAGGG - Intergenic
1118747998 14:68787555-68787577 TAGGGGGAGGCGGAGAGAGAGGG - Intergenic
1119193593 14:72701348-72701370 CAGGGGGAAGGAGAAAGAGAAGG - Intronic
1119263399 14:73251221-73251243 CAGGCGGTGGCAGCAGGAGATGG - Intronic
1119391630 14:74295000-74295022 CAGGGGGAGGTAGAGGGAGAGGG + Intronic
1119514386 14:75236512-75236534 CACTGGGTGACAGAGCGAGACGG - Intergenic
1119533026 14:75376443-75376465 GAGGGAGTGCAAGAGAGAGAGGG - Intergenic
1119635870 14:76273006-76273028 GAGAGGGAGACAGAGAGAGAGGG + Intergenic
1119768744 14:77207069-77207091 CAGGGGGTGCTGGAGACAGAAGG - Intronic
1119820409 14:77610879-77610901 GAGAGGGAGACAGAGAGAGAGGG - Intronic
1120010181 14:79404942-79404964 CAGTGGGTGGTGGTGAGAGATGG + Intronic
1120041575 14:79759045-79759067 CAGGGGGTGGGAGACAAAGTTGG + Intronic
1120138870 14:80904325-80904347 CAGAGGGTGGCGGGGAGAGGGGG + Intronic
1121225277 14:92317233-92317255 CAGGGGATGGCAGAGCCACAAGG + Intergenic
1121233138 14:92372957-92372979 GAGGGGGGGAGAGAGAGAGAGGG - Intronic
1121377991 14:93431180-93431202 TGGGGGGTGGCGGAGAGAGAAGG + Intronic
1121380968 14:93466233-93466255 CAGGTAGTGGAAGAGAGAAAAGG + Intronic
1121468175 14:94129307-94129329 CAGGGGAAGGCAGAGGGAGATGG + Intronic
1121564460 14:94898273-94898295 AAGGGGGAGGAAGAGAGGGAGGG - Intergenic
1121675048 14:95745697-95745719 CAGAGGGTGTGAGAGAGAGCTGG - Intergenic
1121697757 14:95927683-95927705 GAGGGAGAGGCAGAGAGGGAGGG - Intergenic
1121697771 14:95927725-95927747 AAGGGGGAGGGAGAGAGGGACGG - Intergenic
1121697894 14:95928105-95928127 GAGGGAGAGGCAGAGAGGGAGGG - Intergenic
1121697899 14:95928123-95928145 GAGGGAGAGGGAGAGAGAGAGGG - Intergenic
1121697915 14:95928185-95928207 GAGGGAGAGGCAGAGAGGGAGGG - Intergenic
1121697936 14:95928259-95928281 CAGAGAGGGGCAGAGGGAGAGGG - Intergenic
1121798382 14:96754116-96754138 CAGGGTGTGGAAGGGGGAGAGGG + Intergenic
1122214536 14:100194106-100194128 CAGGAGGTTGCAGCCAGAGATGG - Intergenic
1122420704 14:101575158-101575180 TGGGTGGGGGCAGAGAGAGAAGG + Intergenic
1122448159 14:101782941-101782963 GAGAGGGGGGCAGAGAGGGAGGG - Intronic
1122448248 14:101783193-101783215 AAAGGGGGGGGAGAGAGAGAGGG - Intronic
1122488637 14:102098051-102098073 CTGGAGGTGGCAGGGAGGGAAGG - Intronic
1122722553 14:103730425-103730447 CAGGAGGAGGCAGGCAGAGAGGG - Intronic
1122857975 14:104569024-104569046 CTGGGGGTGGCAGTGGGAGCAGG - Intronic
1122977388 14:105176474-105176496 CAGGAGATGGGAGAGAGTGAGGG - Intronic
1123812569 15:23943453-23943475 CAGGGAGGGGGAGGGAGAGAAGG - Intergenic
1123926374 15:25115588-25115610 CAGGGAGCGAGAGAGAGAGAGGG - Intergenic
1123970530 15:25504192-25504214 CAGGGTGGGGCAGAGAAAGATGG - Intergenic
1124245600 15:28069368-28069390 GAGGGGGAGGGAGAGGGAGAGGG - Intronic
1124404606 15:29382424-29382446 CAGGGGCTGGAGGGGAGAGAAGG - Intronic
1124437730 15:29664925-29664947 CAGAAGGTGGCAGAGAAAGTTGG - Intergenic
1125164533 15:36686881-36686903 GGGAGGGTGGGAGAGAGAGAGGG + Intronic
1125394841 15:39235611-39235633 AGTGGAGTGGCAGAGAGAGAGGG - Intergenic
1125526899 15:40382338-40382360 CAGTGGGTGGAAGGGAGTGAGGG - Intergenic
1125764986 15:42128770-42128792 GAGAGGGAGGGAGAGAGAGAGGG + Intergenic
1126096459 15:45094277-45094299 CAGGAGATTGGAGAGAGAGAGGG + Intronic
1126125894 15:45293970-45293992 GAGGGAGAGGCAGAGGGAGAGGG + Intergenic
1126295174 15:47131695-47131717 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1126407098 15:48332237-48332259 CAGGGCATGGCAGAGCCAGAAGG - Intronic
1126840098 15:52709593-52709615 CAGGGGGTGGGAGAGCGATCTGG - Intronic
1127032665 15:54881001-54881023 CGTGGGGAGGAAGAGAGAGAAGG + Intergenic
1127048351 15:55052007-55052029 AAGGGGGTGGGGGAGAGAAAGGG + Intergenic
1127153918 15:56109029-56109051 GAGGGAGTGGGAGAGGGAGAGGG - Intronic
1127582385 15:60349957-60349979 CAGGGGAAGGCAGGGAGGGAGGG + Intronic
1127582400 15:60349993-60350015 CAGGGGAAGGCAGGGAGGGAGGG + Intronic
1127582415 15:60350029-60350051 CAGGGGAAGGCAGGGAGGGAGGG + Intronic
1127582430 15:60350065-60350087 CAGGGGAAGGCAGGGAGGGAGGG + Intronic
1127582469 15:60350155-60350177 CAGGGGAAGGCAGGGAGGGAGGG + Intronic
1128306641 15:66603409-66603431 CTGGGGGAGGGAGAGAGAGAAGG - Intronic
1128388083 15:67164863-67164885 CGGGGAGGGGCAGAAAGAGAGGG - Intronic
1128467456 15:67924893-67924915 CACAGGGTGAGAGAGAGAGAAGG + Intergenic
1128607158 15:69045633-69045655 GAGGGAGGGGGAGAGAGAGAAGG - Intronic
1129162557 15:73754661-73754683 CAGGGAGTGGCTGTGAGAGAAGG + Intergenic
1129164754 15:73770202-73770224 CAGGGAGGGGGAGAGAAAGATGG - Intergenic
1129265884 15:74392845-74392867 CAGTGGATGGGAGAGGGAGAGGG - Intergenic
1129355131 15:74985665-74985687 CACTGGGTGGCAGGGAGGGAAGG + Intronic
1129356294 15:74994404-74994426 AAGGGGGTGGCAGTGAAAAAAGG - Intronic
1129409673 15:75342585-75342607 CAGAGGCTGGAGGAGAGAGAGGG + Intronic
1129518160 15:76169559-76169581 CAGGGGATGGCACAGAGATGTGG + Intronic
1129656831 15:77530015-77530037 CATGGGGTGGCACAGGGTGAGGG + Intergenic
1129672950 15:77617194-77617216 CAGGGGGTGGGAGAGGGTCACGG - Intronic
1129712164 15:77825949-77825971 CAGGGAGAGGGAGAGAGGGAGGG + Intergenic
1129906374 15:79190440-79190462 GAGGAGGTGGAAGAGAGGGAAGG + Intergenic
1129909209 15:79212300-79212322 CAGGGGTTGGCAGAGCCTGATGG + Intergenic
1130173370 15:81541050-81541072 GAGAGGATGCCAGAGAGAGAGGG - Intergenic
1130204506 15:81863761-81863783 GAGGGGGCGGGAGAGAGAGGGGG + Intergenic
1130204512 15:81863777-81863799 GAGGGGGCGGGAGAGAGAGGGGG + Intergenic
1130204518 15:81863793-81863815 GAGGGGGCGGGAGAGAGAGGGGG + Intergenic
1130252745 15:82311271-82311293 AAGGGAGTGAAAGAGAGAGAAGG - Intergenic
1130430677 15:83843887-83843909 CAGAGGGAGGAGGAGAGAGACGG + Intronic
1130663853 15:85853065-85853087 CAGGTGGTGCCAGTGAAAGAGGG - Intergenic
1130904170 15:88228262-88228284 GAGGGGGTGGGAGAGAGAAATGG - Intronic
1130937761 15:88484842-88484864 GAGGAGGAGGCAGAGAGAGCAGG + Intergenic
1131050365 15:89343533-89343555 CAGGTGGGGGCAGAGAGGGAAGG + Intergenic
1131164104 15:90129799-90129821 AAGGAGGTGGCAGAGGGTGAGGG + Intergenic
1131343729 15:91627117-91627139 CAGGAGGAGGGAGAGGGAGAGGG - Intergenic
1131454247 15:92570900-92570922 GTGGGGGTGGCAGTGTGAGATGG - Intergenic
1131468747 15:92676750-92676772 GGGAGGGTGGGAGAGAGAGAGGG - Intronic
1131641569 15:94299017-94299039 GAGGGGGAGGGAGAGAGGGAGGG - Intronic
1131662273 15:94530817-94530839 CAGGGAGTGGGAAGGAGAGAAGG - Intergenic
1132400431 15:101501833-101501855 CACGGCGTGGCAGGAAGAGATGG - Intronic
1132481576 16:168875-168897 CAGGGGGAAGCAAAGAGTGAGGG - Intergenic
1132482822 16:175099-175121 AAGAGGGTGGCAGACAGGGAGGG + Intergenic
1132592830 16:733844-733866 CAGGGGGCGGGAGAGGGCGAGGG - Intronic
1132664629 16:1075961-1075983 GAGGGGGAGGGAGAGAGAGGGGG - Intergenic
1132669688 16:1097510-1097532 CTGGGGCTTGCAGAGAAAGACGG + Intergenic
1133109210 16:3535768-3535790 CAGGGGCTTGGAGAGAGGGAAGG - Intronic
1133172117 16:3987991-3988013 GAGGGGCTGGAGGAGAGAGATGG + Intronic
1133172129 16:3988042-3988064 GAGGGGCTGGAGGAGAGAGACGG + Intronic
1133206946 16:4239666-4239688 CAGGGTCTGTCACAGAGAGACGG + Intronic
1133446542 16:5865896-5865918 CAGGAGGAGAGAGAGAGAGAGGG + Intergenic
1133747988 16:8701929-8701951 GAGGGGGTGGCAGGGAGGGGAGG + Intronic
1133883827 16:9807376-9807398 GAGGGGGAGGGAGAGAGGGAGGG + Intronic
1133908240 16:10040968-10040990 CAGGTGGAGGCAGAGAAGGAAGG - Intronic
1134314180 16:13102921-13102943 CATGGGTTGGCAGAGGGAGGCGG + Intronic
1134332632 16:13265041-13265063 AAGGGGGTGGAAGGGAGGGATGG - Intergenic
1134357798 16:13500606-13500628 TGGGGGGAGGCAGAGGGAGAGGG + Intergenic
1134375213 16:13665894-13665916 AAGGAGGAGGAAGAGAGAGAAGG + Intergenic
1134439105 16:14286929-14286951 CGGGAGGTGACAGGGAGAGAGGG + Intergenic
1134750338 16:16619888-16619910 CAGGGGGAGGGGGAGGGAGAGGG + Intergenic
1134794568 16:17023194-17023216 CAGGAGGGGGCAGTGAGAAAGGG + Intergenic
1134885641 16:17789065-17789087 GAGGGGGAGGGAGAGAGAGAGGG - Intergenic
1135149734 16:19995035-19995057 CAGGGGGTGGCGGAAATGGATGG + Intergenic
1135160230 16:20087947-20087969 CAGGGGCTGGGACAGAGATATGG - Intergenic
1135186670 16:20321738-20321760 CAGGGTGTGGGAGAAGGAGATGG + Intronic
1135566745 16:23516955-23516977 CAGGAGGGTGGAGAGAGAGAAGG + Intronic
1135660527 16:24292575-24292597 GAGGGGATGGGAGAGAGAGGAGG - Intronic
1135768390 16:25197600-25197622 CTGGGGGAGGCTGAGAGGGAAGG - Intergenic
1135802914 16:25515682-25515704 CAGAGGGTGGGAGAGTGGGAGGG + Intergenic
1136024545 16:27461311-27461333 CAGGCGGTGGCTGGGAGGGAGGG + Exonic
1136033287 16:27519091-27519113 CAGGGGACAGCAGAGAGAGGAGG + Intronic
1136187801 16:28598187-28598209 CAGGGGGTGGCACAGAAAAGAGG + Intergenic
1136553262 16:30992978-30993000 CAGAGGGTGGCAGGGAGAAGAGG + Intronic
1136624486 16:31453672-31453694 GATGGGGTGGCAGGGAGACAGGG + Intergenic
1136629097 16:31479018-31479040 CTGGGGGTGGGAGTGAGAAAGGG - Intergenic
1137036579 16:35574297-35574319 CAGCGGGTGGAAGCGAGGGATGG - Intergenic
1137295910 16:47093197-47093219 GAGGGAGTGGCAGAGAAAGGAGG - Intronic
1137303710 16:47180353-47180375 GAGGGGGAGGGAGAGGGAGAGGG - Intronic
1137357457 16:47780407-47780429 CTGGGGGTGGGAGAGGGAGGAGG + Intergenic
1137480210 16:48846258-48846280 CAGGTGGAGGCAGAGAGAAATGG - Intergenic
1137564405 16:49524428-49524450 CAGAGTGTGGCAGTGACAGATGG + Intronic
1137564957 16:49527091-49527113 CAGGGGCTGGCAGAGACAGCAGG + Intronic
1137613684 16:49835103-49835125 CAGGGGGTGGGAGAAAGTGAAGG - Intronic
1138070191 16:53985102-53985124 CTGGGGGTTGGGGAGAGAGAAGG + Intronic
1138096375 16:54215124-54215146 CAGGAGGAGGCACAGTGAGAAGG - Intergenic
1138187392 16:54987082-54987104 CAGGGGCTTGCAGAGAGGGAAGG + Intergenic
1138197616 16:55063308-55063330 CAGGCTGTGGCACAGGGAGAGGG + Intergenic
1138410577 16:56836560-56836582 GAGGGGGAGGAAGAGAGAGACGG - Intronic
1139246655 16:65451483-65451505 CAGGGGGTGGTAGGGGGTGAGGG - Intergenic
1139474960 16:67198553-67198575 CAGGGGGTGGGGGATAGCGAAGG - Exonic
1139739944 16:69026662-69026684 CAGGGCATGGCAGAGTGAGAAGG + Intronic
1139802521 16:69535019-69535041 CAGGGTTTGGCACAGAGTGAAGG + Intergenic
1139848461 16:69936501-69936523 TAGTGGGTTGCAGAGAAAGATGG + Intronic
1139863999 16:70050293-70050315 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1140068002 16:71626451-71626473 CCGGGAGAGGGAGAGAGAGAGGG + Exonic
1140248322 16:73271340-73271362 CAGTGGGTGCCACAGGGAGATGG - Intergenic
1140506658 16:75477861-75477883 CAGTGAGTGGCAGAGCAAGAGGG - Exonic
1140655164 16:77132418-77132440 GAGGGGGAGGAAGAGAGGGAGGG - Intergenic
1140828067 16:78726103-78726125 GAGAGGGAGGCAGAGAGGGAGGG - Intronic
1140924795 16:79571924-79571946 CAGGGGCTGGCAAAGAAAGGGGG - Intergenic
1141141632 16:81500309-81500331 CAGAGGGAGGCAGGGAGGGAGGG - Intronic
1141196258 16:81863842-81863864 CAGGAGGTGGCAAAGGGTGAGGG + Intronic
1141278780 16:82611775-82611797 CAGGGGGTGATGGAGGGAGAGGG + Intergenic
1141326170 16:83061426-83061448 CCGGGGTTGGCACAGGGAGAAGG - Intronic
1141668956 16:85481436-85481458 AAGGAGGTGGTAGGGAGAGAAGG + Intergenic
1141753439 16:85975252-85975274 CAGGGTGTGACTGAGACAGAGGG - Intergenic
1141757036 16:85998144-85998166 CCAGGGGTGGCAGAGGGAGGAGG - Intergenic
1141762914 16:86040407-86040429 GAGGGAGAGGAAGAGAGAGAGGG - Intergenic
1141762920 16:86040443-86040465 GAGGGAGAGGAAGAGAGAGAGGG - Intergenic
1141812331 16:86383762-86383784 GTGGGGGAGGGAGAGAGAGAGGG + Intergenic
1141882419 16:86868776-86868798 GAGGGGGTGAGACAGAGAGAAGG + Intergenic
1141926593 16:87174105-87174127 AAGGGGGTGCCAGGAAGAGAAGG - Intronic
1141927402 16:87178521-87178543 GAGAGGGAGGCAGAGAGAGGAGG - Intronic
1141927410 16:87178554-87178576 GAGAGGGAGGCAGAGAGAGGAGG - Intronic
1141927419 16:87178590-87178612 GAGAGGGAGGCAGAGAGAGAAGG - Intronic
1141927451 16:87178722-87178744 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
1141941582 16:87279386-87279408 CACGGGGTGGGAGAGAGAGCAGG + Intronic
1142011603 16:87718289-87718311 GAGGGGGAGGGAGAGGGAGAGGG - Intronic
1142090871 16:88208514-88208536 GGGAGGGTGGGAGAGAGAGAGGG + Intergenic
1142235701 16:88921548-88921570 CAGGGGGCTGCAGACAGAGAGGG - Intronic
1142261214 16:89043309-89043331 AGGGTGGTGGCAGACAGAGAGGG - Intergenic
1142263417 16:89052873-89052895 CAGGCGGGGGCAGAGAGAAGGGG + Intergenic
1142358944 16:89617199-89617221 GAGGGAGTGGCAGAGAGATGGGG + Intronic
1142360724 16:89625314-89625336 GAGAGGGAGGCAGAGAGTGAGGG + Intronic
1203142404 16_KI270728v1_random:1776858-1776880 TAAGAGGAGGCAGAGAGAGAAGG - Intergenic
1142627174 17:1199494-1199516 TTGGGGGTGGAAGGGAGAGACGG + Intronic
1142669775 17:1482769-1482791 GAGGGGAGGGCAGGGAGAGAAGG - Intronic
1142715054 17:1742774-1742796 CAGGGGTTGGCTGAGAGTAAAGG + Intergenic
1142719646 17:1767525-1767547 CAGGCTGTGGCAGGGAGTGAGGG + Intronic
1142859002 17:2749674-2749696 CGGGGGGCGGGAGAGAGAAAGGG + Intergenic
1142896321 17:2981379-2981401 AAGGGGTGGGCAGGGAGAGAGGG - Intronic
1142949027 17:3463939-3463961 GAGGGAGAGGCAGAGGGAGAGGG - Intronic
1142994128 17:3750962-3750984 CAGGGGTGGGGATAGAGAGAAGG + Intronic
1143039857 17:4026030-4026052 CAGGGAGATGCAGAGAGAGAGGG + Intronic
1143248492 17:5504955-5504977 CAGTGGGTGGGTGGGAGAGAAGG + Intronic
1143259310 17:5586229-5586251 CAGGGAGGGGCAGGGAGAGTAGG - Intronic
1143363097 17:6387348-6387370 CACATTGTGGCAGAGAGAGAAGG - Intergenic
1143490064 17:7281179-7281201 CAGGCGGGGGCGGAGAGACAGGG - Intergenic
1143523472 17:7459534-7459556 CGGGTGGTGGCAGAGTGAGAAGG - Exonic
1143742785 17:8966127-8966149 AAGTGGGTCGCAGTGAGAGAAGG - Intergenic
1143784037 17:9243697-9243719 CAGGAGGGGGCAGAGGGAGGAGG - Exonic
1143823194 17:9581561-9581583 CAGAGGGAGACAGAGAGGGAGGG + Intronic
1143948069 17:10611578-10611600 CGGGCGGTGGAAGACAGAGATGG - Intergenic
1144338225 17:14291135-14291157 CAGGGGTTAGTAGAGAGGGAGGG + Intergenic
1144465500 17:15493671-15493693 GAGGGGGAGGGAGAGAGGGAGGG - Intronic
1144559967 17:16312927-16312949 AAGGGGGGGGGAGAGGGAGAGGG + Intronic
1144628960 17:16860524-16860546 AAGGGGGTAGCAGACAGAGAGGG - Intergenic
1144642876 17:16948186-16948208 AAGGGGGAGGCAGAGAGAGAGGG + Intronic
1144652451 17:17015591-17015613 ACGGGGGTAGCAGACAGAGAGGG + Intergenic
1144680668 17:17191704-17191726 CAGTGGGGGGCAGGGAGTGATGG - Exonic
1144717713 17:17445969-17445991 CAGTGGGTGGCAGTCACAGAAGG - Intergenic
1144775268 17:17782012-17782034 CGCGGGGTGGGAGGGAGAGAGGG + Intronic
1144866197 17:18337542-18337564 GAGGGGGAGGGAGAGGGAGAGGG - Intronic
1144956252 17:19020299-19020321 GAGGGGGTTGCAGAAGGAGAGGG - Intronic
1145015369 17:19393084-19393106 CAGGATGTGGCAGAGAGAAGAGG + Intergenic
1145047476 17:19628907-19628929 CAGGGAGAGGGAGAGGGAGAGGG + Intergenic
1145160531 17:20571091-20571113 ACGGGGGTAGCAGACAGAGAGGG - Intergenic
1145193738 17:20868973-20868995 AAGGGGGGGGAAGGGAGAGAAGG + Intronic
1145417938 17:22740485-22740507 GAGGGAGAGGGAGAGAGAGAGGG - Intergenic
1145772952 17:27506664-27506686 GAGGGGGTGGGAGGGGGAGATGG - Intronic
1146297157 17:31659171-31659193 AAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1146297219 17:31659335-31659357 AAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1146483473 17:33224389-33224411 CAGAAGGTGGCAGAGAGGGGAGG + Intronic
1146652157 17:34613602-34613624 TAGGGGGAGGCGGAGAAAGAGGG - Intronic
1146950149 17:36900027-36900049 CAGGTGGTGGCAGAGATGCAGGG + Intergenic
1147261298 17:39210949-39210971 GAGGGGGTGGAAGACAGACAAGG - Exonic
1147403989 17:40197630-40197652 CAGAGGGAGGGAGAGAGGGAGGG + Intergenic
1147558904 17:41497062-41497084 CAGCGGGTGGCACACAGAGGTGG - Intergenic
1147590609 17:41680842-41680864 CAGGTGGTGGCAGAGAAGGCTGG + Intergenic
1147701923 17:42401619-42401641 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1147703382 17:42409819-42409841 CAGGGGATGGCAAGGAGGGACGG + Intronic
1147784875 17:42972297-42972319 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
1147899542 17:43774988-43775010 CAGGGGGAGGAAGATGGAGAAGG + Intronic
1147932062 17:43987889-43987911 CAGGGAGGGGCAGAGAGCGGTGG + Intronic
1147952133 17:44113132-44113154 CTGGGGCAGGCAGAGAGAGCTGG - Intronic
1147978813 17:44262442-44262464 CAGGAGGTGGCTGGGAGAGCAGG - Intronic
1148051027 17:44769969-44769991 GAGGAGGTGGCTGAGACAGAGGG - Exonic
1148222686 17:45875110-45875132 CAGGGGTTAGCAGGGAGGGAGGG - Intergenic
1148328865 17:46800935-46800957 CAGGGGGTAGCACAGAGGCACGG + Intronic
1148891254 17:50808946-50808968 CTGGGGGAGAGAGAGAGAGAGGG + Intergenic
1149645684 17:58239885-58239907 CTGGAGGTTGCAGAGGGAGAGGG - Intronic
1150057373 17:62030533-62030555 CAGAGGCTGGCAGGGACAGAAGG - Intronic
1150119441 17:62587633-62587655 CAGGGCTTAGCAGAGGGAGAAGG + Intronic
1150146559 17:62774229-62774251 ATGGGGGTGGCAGAGTGGGACGG + Intronic
1150257425 17:63758946-63758968 CAGGAGGAGAGAGAGAGAGAGGG + Intronic
1150455472 17:65303694-65303716 TAGGGGGTGGGAGGGAGGGAGGG + Intergenic
1150477825 17:65488009-65488031 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
1150477879 17:65488213-65488235 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
1150477930 17:65488433-65488455 GAGAGGGAGGCAGAGAGAGGGGG + Intergenic
1150477935 17:65488449-65488471 GAGGGGGAGGGGGAGAGAGAAGG + Intergenic
1150477944 17:65488471-65488493 GAGGGGGAGGGGGAGAGAGAAGG + Intergenic
1150477987 17:65488603-65488625 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
1150478041 17:65488824-65488846 GAGAGGGAGGGAGAGAGAGAGGG + Intergenic
1150592750 17:66577926-66577948 GAGGGGGTGGCAGGGTGACAGGG - Intronic
1150957050 17:69870645-69870667 CAGGGGGTGGGTGAGTGAGTAGG + Intergenic
1151271567 17:73000338-73000360 GAGGAGGAGGCAGAGAGAGAGGG - Intronic
1151323922 17:73367456-73367478 CAGGAGGTGGCAGAGGGTGCTGG - Intronic
1151330180 17:73401907-73401929 CGGGGGGGGGCAGAAAGAGCAGG + Intronic
1151525311 17:74661724-74661746 GAGGGGGAGGGAGAGAGGGAGGG + Intergenic
1151871740 17:76841411-76841433 GAGGGAGAGGCAAAGAGAGAGGG - Intergenic
1152409847 17:80117800-80117822 CTGGGGGAGGCACAGGGAGATGG + Intergenic
1152426197 17:80220068-80220090 CTGGGGGCGGCACAGAGAGGAGG + Intronic
1152575199 17:81136801-81136823 CAGAGGGTTGCAAGGAGAGACGG + Intronic
1152591943 17:81218005-81218027 GAGGGGGAGGGAGAGGGAGAGGG - Intronic
1152853768 17:82652049-82652071 AAGGGGGTCGCTGAGAGAGAGGG + Intergenic
1153007822 18:513028-513050 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1153294073 18:3528997-3529019 AAGGATGTGGAAGAGAGAGATGG - Intronic
1153677545 18:7468874-7468896 CAGGCGCTGGCAGACAGAGCAGG - Intergenic
1153839511 18:8993498-8993520 CAGGGGTTAGCAGGGAGGGAAGG + Intergenic
1154157016 18:11951708-11951730 AAGGGGCTGGAAGAGGGAGAAGG + Intergenic
1154168753 18:12035718-12035740 CAGGTAGAGGCAGAGAGAAATGG + Intergenic
1154465785 18:14641958-14641980 GAGTGGGGGGAAGAGAGAGAAGG - Intergenic
1154492922 18:14934848-14934870 CAGGGGCTGCAGGAGAGAGAGGG + Intergenic
1154500803 18:14997044-14997066 GAGGGGGAGGGGGAGAGAGAGGG - Intergenic
1155058089 18:22203124-22203146 CAGGGGGTTGCAGAAATGGAGGG + Intergenic
1155058194 18:22204128-22204150 GAGGGGGAGAGAGAGAGAGAGGG - Intergenic
1155250234 18:23947200-23947222 CAGGGGGTAGGAGAGAGGAAGGG - Intronic
1155310637 18:24519379-24519401 CAGAGAGTGACAGAGAGAGCAGG - Intergenic
1155418607 18:25629070-25629092 CAGTGGGTGGGAGAGAGGTAAGG + Intergenic
1155745699 18:29354813-29354835 CAGTAGGAGGCAGAGAGAGAAGG - Intergenic
1155991874 18:32286651-32286673 TAGTGGCTGGCAGAGAGAGACGG - Intronic
1155996139 18:32333212-32333234 GAGGAGGTGGAAGAGAGACAAGG + Intronic
1156066520 18:33148472-33148494 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
1156260851 18:35444042-35444064 CAGAGAGTGACAGAGAGAGAGGG + Intronic
1156260861 18:35444060-35444082 GAGGGGGGGGGGGAGAGAGAGGG + Intronic
1156502712 18:37569725-37569747 CAGTGGGTGTCAGAGAGAAGAGG - Intergenic
1156631461 18:38974387-38974409 CAGGGTGAGCTAGAGAGAGATGG + Intergenic
1157027135 18:43858255-43858277 CAAGGGGTGGCAGTGATAGAGGG - Intergenic
1157470193 18:47982722-47982744 GAGAGGGAGGGAGAGAGAGAGGG + Intergenic
1157470213 18:47982806-47982828 GAGAGGGAGGGAGAGAGAGAGGG + Intergenic
1157475997 18:48024037-48024059 GAGGGGAGGGCAGAGAGAAAGGG + Intergenic
1157543228 18:48527304-48527326 CAGGGATTAGCAGGGAGAGAGGG - Intergenic
1157700670 18:49759991-49760013 CAGATGGAGGCAGAGAGTGAAGG + Intergenic
1157849014 18:51030371-51030393 CAGGGGGTGGGAGCGGGTGAGGG + Exonic
1157857890 18:51118086-51118108 CAGGGAGAGGGAGAGGGAGAGGG + Intergenic
1158089907 18:53698742-53698764 GAGGAGGAGGAAGAGAGAGAAGG + Intergenic
1158219950 18:55140280-55140302 CACGGTGGGGGAGAGAGAGAAGG + Intergenic
1158444004 18:57502840-57502862 CAGGAGGAGGCAGTGAGGGACGG + Intergenic
1158686918 18:59622853-59622875 CTGGGGGAGGGAGAGAGGGAGGG + Intronic
1158739821 18:60127546-60127568 GAGCGGGAGGAAGAGAGAGAGGG + Intergenic
1159115500 18:64108403-64108425 CAGGTGGGTGCACAGAGAGAAGG + Intergenic
1159759678 18:72408852-72408874 CAGAGGGAGGAAGAAAGAGATGG - Intergenic
1159795331 18:72836226-72836248 CACGGGCTGGCAGAGAAAGGGGG - Intronic
1160054317 18:75464896-75464918 CTGGGGTGTGCAGAGAGAGAGGG + Intergenic
1160068620 18:75604116-75604138 TTGGGGGTGGCAGAAGGAGAGGG + Intergenic
1160387580 18:78505763-78505785 TCGGGGGTGGCAGGGAGGGAGGG - Intergenic
1160571279 18:79819192-79819214 CAGGACGTGTCAGAGGGAGAAGG + Intergenic
1160667671 19:340612-340634 CTCGGGGTGGCAGAGATGGAAGG + Intronic
1160731681 19:644143-644165 CAGTGAGAGCCAGAGAGAGATGG + Intergenic
1161005931 19:1936470-1936492 CAAGGAGAGGGAGAGAGAGAGGG + Intergenic
1161093051 19:2372589-2372611 CAGAGAAAGGCAGAGAGAGAAGG - Intergenic
1161112792 19:2479258-2479280 ACGGGGGAGGGAGAGAGAGAAGG + Intergenic
1161567593 19:5012287-5012309 TGGGGGGTGGCAGGCAGAGACGG - Intronic
1161582850 19:5090392-5090414 GAGGGGGAGAGAGAGAGAGAGGG - Intronic
1161650296 19:5480194-5480216 CAGGGAGGGGCAGAGCGAGCTGG + Intergenic
1161701720 19:5799494-5799516 CGGGAGGTGGCAGAGAGCGGGGG + Intergenic
1161890262 19:7031105-7031127 AAGGGAGTGACAGAGAGGGATGG - Intronic
1161891186 19:7039628-7039650 AAGGGAGTGACAGAGAGGGATGG + Intronic
1161893271 19:7058089-7058111 AAGGGAGTGACAGAGAGGGATGG + Intronic
1161905271 19:7151899-7151921 CATGGGGAGGCTGAGAAAGAAGG - Intronic
1161951433 19:7470109-7470131 CAGGGTCTGGAACAGAGAGAGGG - Exonic
1162012799 19:7828509-7828531 GAGGGAGAGGCAGAGAGAGCTGG + Intergenic
1162054432 19:8054195-8054217 CAGGTGGGGGCAGACAGGGAAGG - Intronic
1162185955 19:8904909-8904931 CTGGGGCTGGCAGAGTGAGGAGG + Intronic
1162425792 19:10594663-10594685 CAGGGGTTGGGAGAGGGAGAAGG - Intergenic
1162572042 19:11479690-11479712 CAGGGCGTGGCAGGGCGGGAGGG + Intronic
1162683055 19:12361672-12361694 GAGGGGGAGGCAGAGGGGGAGGG - Intronic
1162696686 19:12482200-12482222 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
1162900673 19:13793904-13793926 GAGGGGGTGGCAGGGAGAGTGGG + Intergenic
1162904547 19:13816014-13816036 GAGGGAGGGACAGAGAGAGATGG + Intronic
1162905946 19:13824094-13824116 TAGGGGGGGATAGAGAGAGAGGG + Intronic
1162907105 19:13830629-13830651 CAGGGAGTGGCTGAGAGAGCAGG - Exonic
1162924293 19:13922306-13922328 GAGGGGGTGGGTGAAAGAGAAGG - Intronic
1163033688 19:14560109-14560131 CAGGAGGGGGTAGCGAGAGAGGG - Intronic
1163575400 19:18108396-18108418 ATGTGGGTGACAGAGAGAGAGGG - Intronic
1163721384 19:18899776-18899798 CAGGTGGAGGGAGAGAGAGAGGG + Intronic
1163785813 19:19274415-19274437 GAGGGGGTGACAAAGACAGATGG - Intergenic
1163912932 19:20213845-20213867 GAGGGGGAGGCGGAGGGAGAGGG - Intergenic
1164260864 19:23567865-23567887 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
1164507841 19:28874166-28874188 GAGGGGGTGGAAGAGATGGAGGG + Intergenic
1164581614 19:29438664-29438686 GAGGGGGAGGGAGAGAGACAGGG + Intergenic
1164581653 19:29438773-29438795 GAGGGGGAGGGAGAGACAGAGGG + Intergenic
1164581748 19:29439135-29439157 CAGGGAGAGGGAGAGAGAGTGGG + Intergenic
1164603006 19:29576235-29576257 CAGGCGGTGCCTGGGAGAGATGG + Intergenic
1164771855 19:30815888-30815910 CAGGGAGTGGGAGGGAAAGAAGG - Intergenic
1164956682 19:32392400-32392422 AAGGGGGAGGGAGAGAGGGAGGG + Intergenic
1165359422 19:35326788-35326810 CTGTGTGTGGCAGAGAGAGGGGG + Intronic
1165386015 19:35511072-35511094 CGTGGGGTGGCGGAGAAAGAGGG - Intronic
1165422717 19:35730313-35730335 GAGGGGGTGGCAAAGTGAGGTGG - Intronic
1165564099 19:36708630-36708652 CAGGGGGTAGCAGGGAGGGAGGG - Intronic
1165646245 19:37440405-37440427 CAGGGGCTAGGAGTGAGAGAGGG + Intronic
1165818452 19:38658468-38658490 CAGGGAGTGACAGAGAGAAAAGG - Intronic
1165907965 19:39205017-39205039 CGGGGGGGGGCAGGTAGAGAAGG + Intergenic
1166161757 19:40959340-40959362 GAGGGAGAAGCAGAGAGAGATGG - Intergenic
1166161885 19:40960342-40960364 ATGGGGGAGACAGAGAGAGATGG - Intergenic
1166195627 19:41203827-41203849 GAGGGGGTGTCAGAGAAAGAAGG - Intronic
1166231487 19:41427645-41427667 CAGGGGGTGCCAGGGAGGGTGGG + Intronic
1166305215 19:41933506-41933528 GAGGGGCTGGGAGAGAGAGATGG + Intergenic
1166645434 19:44528095-44528117 CAGGAAGGGGCAGAAAGAGAGGG - Intronic
1166746874 19:45145820-45145842 GAGGGGGTGGGGGAGAGGGAGGG - Exonic
1166872244 19:45877713-45877735 CAGGCTGTGGCAGAGAGGGGGGG - Intergenic
1167104622 19:47423003-47423025 GAGGGAGAGACAGAGAGAGAGGG - Intergenic
1167104626 19:47423031-47423053 GAGGGAGAGACAGAGAGAGATGG - Intergenic
1167104641 19:47423193-47423215 GAGGGAGAGACAGAGAGAGATGG - Intergenic
1167168262 19:47813892-47813914 CAGGGGGCGGCAGAGGACGAGGG + Intronic
1167220091 19:48193624-48193646 CAAAAGGAGGCAGAGAGAGATGG + Intronic
1167260425 19:48454878-48454900 CAGAGAGAGGCAGAGAGAGATGG - Exonic
1167293362 19:48636177-48636199 ACGGGGGTGGCAGAGACAGGTGG + Intronic
1167384857 19:49157410-49157432 CAGGGATAGACAGAGAGAGAGGG - Intergenic
1167609342 19:50499508-50499530 CAGAGGGAGAGAGAGAGAGAGGG + Intergenic
1167609396 19:50499936-50499958 GAGAGGGTGACAGAGGGAGAGGG + Intergenic
1167791927 19:51688600-51688622 CAGGAAGGGGGAGAGAGAGACGG + Intergenic
1167792720 19:51691175-51691197 GAGGGGGAGGGAGAGAGGGAAGG + Intergenic
1167797643 19:51720008-51720030 CGGAGGGAGGGAGAGAGAGAGGG - Intronic
1167852040 19:52209674-52209696 CAGGGGCTGGGGGAGAGGGAAGG - Intronic
1167913448 19:52721733-52721755 AAGGGAGAGGGAGAGAGAGAGGG + Intronic
1167971243 19:53188600-53188622 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
1168092732 19:54096320-54096342 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092738 19:54096350-54096372 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092741 19:54096366-54096388 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092744 19:54096382-54096404 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092747 19:54096398-54096420 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092750 19:54096414-54096436 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092753 19:54096430-54096452 GAGAGGCAGGCAGAGAGAGAGGG - Intronic
1168092763 19:54096492-54096514 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092766 19:54096508-54096530 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092769 19:54096524-54096546 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092772 19:54096540-54096562 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092775 19:54096556-54096578 GAGAGGCAGGCAGAGAGAGAGGG - Intronic
1168092780 19:54096588-54096610 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092783 19:54096604-54096626 GAGAGGGAGGCAGAGAGAGAGGG - Intronic
1168092786 19:54096620-54096642 GAAAGGGAGGCAGAGAGAGAGGG - Intronic
1168099500 19:54133790-54133812 GAGAGGGAGGAAGAGAGAGAGGG - Intergenic
1168099508 19:54133819-54133841 GAGAGGGAGGGAGAGAGAGAGGG - Intergenic
1168099517 19:54133850-54133872 GAGAGGGAGGGAGAGAGAGAGGG - Intergenic
1168240921 19:55088541-55088563 CAGGGCTTGCCAGAGGGAGAAGG - Intergenic
1168307618 19:55443866-55443888 CAGGGAGAGAGAGAGAGAGAGGG - Intergenic
1168342382 19:55632602-55632624 CAGGAGGAGGCAAAGAAAGAGGG + Intergenic
1168528440 19:57106683-57106705 GAGGGGGTGGCAGCAGGAGAAGG - Intergenic
925188711 2:1866491-1866513 GAGAGGCAGGCAGAGAGAGAAGG + Intronic
925188729 2:1866577-1866599 GAGAGGCAGGCAGAGAGAGAGGG + Intronic
925188751 2:1866675-1866697 GAGAGAGAGGCAGAGAGAGAGGG + Intronic
925188763 2:1866733-1866755 GAGAGAGAGGCAGAGAGAGAGGG + Intronic
925189934 2:1874658-1874680 CACAGGGTGGCAGAGCCAGAGGG + Intronic
925462530 2:4075774-4075796 GAGAGGGGGGCAGAGAGGGAGGG - Intergenic
925650557 2:6085267-6085289 CATGGGGCGGGAGACAGAGAAGG + Intergenic
925833287 2:7917630-7917652 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
925868329 2:8248008-8248030 CAGGGGCTGGAAGAGACAGCTGG + Intergenic
926144522 2:10388558-10388580 CTGGGGGCAGCAGAGACAGACGG - Intronic
926215734 2:10903900-10903922 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
926542842 2:14202902-14202924 GGGGGGGTGGGAGAGAGGGAGGG + Intergenic
926579139 2:14615638-14615660 TAACGGGTGGGAGAGAGAGAAGG - Intergenic
926735537 2:16070720-16070742 CAGGGGGTGCCTGGGAGAGGTGG - Intergenic
927240557 2:20916607-20916629 GATGGAGAGGCAGAGAGAGATGG - Intergenic
927466507 2:23340668-23340690 CAGGGGATGGCAGAGTGCCATGG + Intergenic
927490869 2:23520098-23520120 CAGGGAGTGGCAGAGAGAGGAGG + Intronic
927497581 2:23561168-23561190 CATGGAGAGGCAGAGACAGAGGG - Intronic
927514966 2:23666881-23666903 CAGGGCTGGGCACAGAGAGAAGG - Intronic
927911384 2:26902158-26902180 CGTGGGGTGGCAGGGGGAGAGGG + Intronic
928005631 2:27558919-27558941 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
928100050 2:28431649-28431671 CTGTCTGTGGCAGAGAGAGATGG - Intergenic
928393005 2:30923611-30923633 GACAGGGTGGCAGACAGAGAGGG + Intronic
928429683 2:31206951-31206973 TAGAGGGTGGGAGAGCGAGAAGG + Intronic
928938742 2:36706533-36706555 AAGAGGACGGCAGAGAGAGATGG - Intronic
929110464 2:38402589-38402611 AAGGGAGAGGGAGAGAGAGAGGG - Intergenic
929110483 2:38402651-38402673 AAGGGAGAGGGAGAGAGAGAGGG - Intergenic
929171141 2:38934506-38934528 AAGGGGGAGGGAGGGAGAGAAGG - Intronic
929171149 2:38934525-38934547 AAGGGGGAGGGAGGGAGAGAAGG - Intronic
929560072 2:42951034-42951056 CAGGGGGTGACTGAGCGAGGGGG + Intergenic
929609188 2:43257285-43257307 CTGGGAGAGGCAGAGAGGGAAGG + Intronic
929723022 2:44390538-44390560 GTGGGGGAGGGAGAGAGAGAGGG + Intronic
929900248 2:45994446-45994468 CAGGGGTTAGGAGAGAGGGAGGG - Intronic
929993831 2:46812480-46812502 CTGGGAGAGGCAGAGGGAGAAGG + Intergenic
930049652 2:47205215-47205237 CAGAGGATGGTAGAGAGGGAAGG + Intergenic
930259295 2:49126321-49126343 AAGAGGGGGGGAGAGAGAGAGGG + Intronic
930663256 2:54076710-54076732 CAGGGAGGGAGAGAGAGAGAGGG + Intronic
930752260 2:54945212-54945234 AAGGGGGAGGGAGAGAGAGAAGG - Intronic
930752268 2:54945242-54945264 AAGGGGGAGGGAGAGAGAGAGGG - Intronic
930752277 2:54945272-54945294 AAGGGGGAGGCAGAGAGAGAGGG - Intronic
930886506 2:56332663-56332685 AAAGGGGGGGCAGTGAGAGAGGG - Intronic
931170400 2:59797370-59797392 CAGAGTGTGGAGGAGAGAGAGGG - Intergenic
931809992 2:65845495-65845517 AAGGGGGAGGAAGAGAAAGAAGG - Intergenic
931870173 2:66447817-66447839 AAGAGGGAGACAGAGAGAGAGGG - Intronic
932211423 2:69934455-69934477 CACGGAGTGGGAGAGGGAGAAGG - Intronic
932356686 2:71073322-71073344 CAGGGGGTGGGAGAGGGGGGTGG - Intronic
932407392 2:71522577-71522599 CAGGTGGTGTCTGAAAGAGACGG - Intronic
932729422 2:74207886-74207908 GATGGGGAGGGAGAGAGAGAGGG - Intronic
932741426 2:74293737-74293759 CTTGGGGAAGCAGAGAGAGAAGG - Intronic
932801283 2:74744619-74744641 CCAGGGGTGGCAGTCAGAGAGGG + Intergenic
932940366 2:76157776-76157798 CAGAGGGTGGTAGAGGCAGAGGG + Intergenic
933628729 2:84632389-84632411 CCAGGAGTGGCAGAGAAAGAGGG + Intronic
933770094 2:85738257-85738279 TAGGGAGTGGGTGAGAGAGAGGG - Intergenic
933847822 2:86339503-86339525 CAGGGTCTGTCACAGAGAGAGGG - Intergenic
933869356 2:86550442-86550464 AAGGGAGAGGGAGAGAGAGAGGG + Intronic
933971689 2:87474754-87474776 CAGGGGGTGCCAGTGAGTGGAGG + Intergenic
934088438 2:88529655-88529677 CAGAGGGAGGAAGAGAGAGAGGG + Intergenic
934729903 2:96649924-96649946 CAAGGGGCTGCAGAGAGACAAGG + Intergenic
934737739 2:96698544-96698566 CTGAGGGTGGCAGGGATAGAAGG - Intergenic
934781293 2:96971298-96971320 CAGAGGGAAGGAGAGAGAGAGGG - Intronic
934912359 2:98270958-98270980 CGGGGAGTGGGAGACAGAGAAGG - Intronic
935333166 2:101992105-101992127 GAGAGGGAGGCAGAGAGAGAGGG + Intronic
935373175 2:102368588-102368610 CAGCTGGCGGCAGTGAGAGAGGG + Intronic
935580734 2:104754062-104754084 CAGAGGCTGGCCCAGAGAGATGG - Intergenic
935929564 2:108109263-108109285 CAGGGTGTTGCAGGGAGAGGAGG - Intergenic
936322040 2:111475445-111475467 CAGGGGGTGCCAGTGAGTGGAGG - Intergenic
936475549 2:112836569-112836591 GAGAGGGAGGCAGAGAGGGAAGG + Intronic
936500766 2:113064492-113064514 CGGTGGGTGGCAGAGAGAGAGGG - Exonic
936617809 2:114066345-114066367 GTGGGGGTGGCAGAGAAAGAAGG + Intergenic
937168951 2:119845260-119845282 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
937219934 2:120336942-120336964 CAGGGGGTGGCAGGGAGTCCAGG - Intergenic
937268177 2:120630286-120630308 AAGGGGGTGGCAGAGTGGGGAGG + Intergenic
937320876 2:120960024-120960046 CAGAGAAAGGCAGAGAGAGAAGG - Intronic
937497013 2:122431117-122431139 TAGTGGATGTCAGAGAGAGAGGG + Intergenic
937903566 2:127040587-127040609 CTGAGGATGGCAGAGCGAGAAGG - Intergenic
937930895 2:127204644-127204666 CAGGGTGTGGGAAAGAAAGAGGG + Intronic
937972853 2:127564098-127564120 CAGGGAGGGGAAGAGAGAGCGGG + Intronic
938533603 2:132220304-132220326 CAGGGAGAGGGAGAGGGAGAGGG - Intronic
938533611 2:132220328-132220350 CAGGGAGAGGGAGAGGGAGAGGG - Intronic
938571707 2:132567483-132567505 CAGGGCATCGCACAGAGAGAGGG - Intronic
939029881 2:137059534-137059556 CAGGGGTTCTCAGGGAGAGAGGG - Intronic
939186041 2:138861733-138861755 CAAGGGGTGGGAGAGAGATGGGG + Intergenic
939476035 2:142687213-142687235 CGGAGGGAGACAGAGAGAGAAGG + Intergenic
939779781 2:146431635-146431657 AAGGGAGAGGCAGGGAGAGAAGG + Intergenic
940000212 2:148959930-148959952 GAAGGGGAGCCAGAGAGAGAAGG - Intronic
940274911 2:151929151-151929173 CAGGGGGAAGCAAGGAGAGATGG + Intronic
940465874 2:154025951-154025973 CATGGGGAGGGAGAGAGAGAAGG + Intronic
940668045 2:156632978-156633000 CAAGGAGGGGCAAAGAGAGAGGG + Intergenic
940771668 2:157845380-157845402 CATGGAGAGGCACAGAGAGAAGG + Intronic
940949473 2:159656485-159656507 CAGGGTGAAGTAGAGAGAGAGGG - Intergenic
940988664 2:160075515-160075537 CAGGTGGTAGCAGGCAGAGAGGG + Intergenic
941625649 2:167827590-167827612 CAGGGACTGCCAGAGAGGGAAGG - Intergenic
941768532 2:169326156-169326178 GAGGGGGAGGGAGAGGGAGAGGG - Intronic
941930051 2:170929708-170929730 GGGGGGGTGGAGGAGAGAGAAGG - Intronic
942111976 2:172691571-172691593 CAGGGGTTAGGAGAGAGGGAGGG - Intergenic
942184661 2:173413683-173413705 CAGGGGATGGGAGCAAGAGAGGG - Intergenic
942302215 2:174572820-174572842 CAAGGGCTGGGAGACAGAGATGG - Intronic
942510354 2:176692403-176692425 CAGGGGCTGGGGTAGAGAGAAGG - Intergenic
942594546 2:177580574-177580596 CAGGGCATGGCAGTGGGAGAAGG - Intergenic
942716353 2:178896954-178896976 GAGGGGGTGGCAGGGGGAGAAGG - Intronic
942753037 2:179309374-179309396 CAGAGAGAGACAGAGAGAGAAGG + Intergenic
942842059 2:180374090-180374112 GAGGGAGTGGGAGAGAGTGAAGG - Intergenic
943442506 2:187943323-187943345 GAGGGGTTGGCAGGGAGAGGGGG - Intergenic
943617918 2:190115197-190115219 CAGAGAGAGACAGAGAGAGAAGG + Intronic
943773189 2:191741163-191741185 CAGGGAGAGGGAGAGGGAGACGG - Intergenic
944304942 2:198168698-198168720 AAGGGGATGGCAGAAAGTGAAGG + Intronic
944590243 2:201210207-201210229 CAGCATGTGGCAGAGACAGAAGG - Intronic
944689271 2:202145256-202145278 GAGGGGTGGGGAGAGAGAGAAGG - Intronic
944998457 2:205321478-205321500 CGGGGGGAGAGAGAGAGAGAGGG - Intronic
945185532 2:207135958-207135980 GAGGAAGTGGCAGAGGGAGAGGG - Intronic
945196415 2:207241245-207241267 CATGGGGTCTGAGAGAGAGAGGG - Intergenic
945232762 2:207609775-207609797 GAGGGGGAGGGAGAGGGAGAGGG - Exonic
946039361 2:216770661-216770683 CAGGGGGTGGAATAGAAACAAGG - Intergenic
946345268 2:219104611-219104633 CAGAAGGTGGTAGAGAAAGAGGG + Intronic
946371754 2:219285520-219285542 CAGGGAGTTGCAGAGAGAATGGG - Exonic
946416174 2:219540910-219540932 CTGGGGGTGGCAGAGTGACGGGG - Intronic
946631488 2:221674039-221674061 TTGGGGGAGGCAGGGAGAGAGGG + Intergenic
946782494 2:223205689-223205711 CCTGTGGTGGCAGAGAGAGTAGG - Intergenic
946807926 2:223490709-223490731 AAGTGGATGGCCGAGAGAGAAGG - Intergenic
946855112 2:223944190-223944212 CAGGGGGAGGAAGAGAGCGAAGG + Intronic
946864548 2:224031287-224031309 AAGGGTGTGGCAGAGATAAAGGG - Intronic
946921211 2:224584466-224584488 GGGAGGGGGGCAGAGAGAGAGGG + Intronic
947124938 2:226858829-226858851 AAGGTTGTGGCAGAGAGAAATGG - Intronic
947411269 2:229843088-229843110 GAGAGGGAGGGAGAGAGAGAAGG - Intronic
947844894 2:233236157-233236179 CCAGGGGTGGCAGAGAGGGTGGG + Intronic
947856498 2:233327988-233328010 CAGGGGGTGGGAGAATGGGAAGG - Intronic
947965719 2:234279944-234279966 CAGGGTGGGGCAGAGACAGCTGG - Intergenic
947971201 2:234327007-234327029 GAGGGGGAGGCAGAGAGAGAAGG - Intergenic
948280890 2:236747348-236747370 CGTGGTGTGGCAGAGAGTGATGG + Intergenic
948295473 2:236857209-236857231 GAGGGGGCGGGAGAGAGAGAGGG - Intergenic
948353154 2:237357372-237357394 CAGGGTGTCCCAGGGAGAGATGG - Exonic
948477269 2:238228048-238228070 CAGAGAGAGGCAGAGAGACAGGG + Intronic
948581299 2:238988830-238988852 AGGGCGGTGGCAGAGACAGATGG - Intergenic
948651837 2:239450409-239450431 CAGGGAGAGGGAGAGGGAGAGGG + Intergenic
948722668 2:239911370-239911392 GAGCTGGTGGCAGGGAGAGAGGG - Intronic
948820434 2:240540902-240540924 CTGGGGCTGGCAGAGAGAGACGG - Intronic
949064544 2:241981769-241981791 CAGGGGGTGGCAGAGGGGAAGGG + Intergenic
1168848332 20:960026-960048 CAAGAGGAGGGAGAGAGAGAAGG + Exonic
1168965374 20:1895174-1895196 CAGGGGCGGCCAGAGAGAGGCGG - Intronic
1169070234 20:2722618-2722640 CAGGCTGTGGCATAGGGAGAAGG - Intronic
1169134954 20:3191538-3191560 CAGGGGCTGGCAGAGTGATGGGG + Intronic
1169192973 20:3669510-3669532 CAGGGGGAGGTGGAGAGGGAAGG - Intronic
1169387209 20:5160711-5160733 CAGGGGCTGGGGGAGTGAGAGGG - Intronic
1169499895 20:6148860-6148882 CTGAAGGTGGCAGAGAGTGAAGG + Intergenic
1170081879 20:12485509-12485531 CAGGGAGTGGAAGACAGAGAAGG - Intergenic
1170737839 20:19026581-19026603 CAGGGGTTGGGGAAGAGAGAGGG + Intergenic
1170886004 20:20340351-20340373 CAGAGGGAGGCAAGGAGAGAGGG + Intronic
1170888830 20:20363186-20363208 AAGGAGGGGGGAGAGAGAGAAGG + Intergenic
1171171870 20:23022552-23022574 CAGGGGGCAGCAGTGAGAGAAGG + Intergenic
1171172319 20:23026510-23026532 CAGGGGGCAGCAGTGAGAGAAGG + Intergenic
1171201535 20:23245984-23246006 CAGCGGCTGGCACAGAGGGAGGG + Intergenic
1172122466 20:32606868-32606890 CAGAGGGAGACAGAGACAGAGGG - Intronic
1172199425 20:33114927-33114949 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1172250289 20:33474736-33474758 CAGGGGATGCCAGAGGGAGGAGG + Intergenic
1172271126 20:33656437-33656459 CTGGGGGTGCCAGGGGGAGAGGG - Intergenic
1172422041 20:34825674-34825696 GAGGGGGAGGGAGGGAGAGAGGG + Intergenic
1172537942 20:35688723-35688745 CAGAGGGAGAGAGAGAGAGAGGG + Intronic
1172606333 20:36216736-36216758 CTGGGAGAGACAGAGAGAGAAGG + Intronic
1172778917 20:37424192-37424214 GAGAGGGAGGGAGAGAGAGATGG + Intergenic
1172848788 20:37945507-37945529 CCGGTGGGGGCAGAGGGAGAGGG + Intergenic
1173053043 20:39583728-39583750 CAGGGGATGGGAGGGAGAGGGGG + Intergenic
1173153613 20:40588871-40588893 AAGGAGGTGGAAGAGAGAGTTGG - Intergenic
1173305212 20:41841281-41841303 CAGAGGGAGGCAGGGAGGGAAGG - Intergenic
1173397289 20:42691251-42691273 AAGGGGGTGGTAGGGAGTGAGGG + Intronic
1173443168 20:43095828-43095850 AAGGGAGAGGGAGAGAGAGAGGG - Intronic
1173475224 20:43354002-43354024 CAGGGTGTCCCAGAGAGGGAGGG - Intergenic
1173486978 20:43448304-43448326 CAGGGAGAGGGAGAGGGAGAGGG + Intergenic
1173593069 20:44240483-44240505 CAAGGGAGGGCAGAAAGAGATGG + Intergenic
1173606566 20:44336179-44336201 CAGGTGAAAGCAGAGAGAGAGGG + Intergenic
1173702320 20:45083735-45083757 CAGAGGGAGGGAGAGAGGGATGG + Intergenic
1173735503 20:45358541-45358563 GAGGGGGAGGAAGGGAGAGAGGG + Intergenic
1173980172 20:47217910-47217932 CAGGGAGTGGAAGGGAGAGGAGG - Intronic
1174045481 20:47729806-47729828 CAGAGAGTGGCAGGGAAAGAGGG + Intronic
1174163133 20:48565667-48565689 CTGGGGTTGGCAGAGGAAGAAGG - Intergenic
1174297753 20:49561150-49561172 CAGAGGGAGGTAGAGAGGGAGGG - Intronic
1174324319 20:49767116-49767138 CAGGGAGTGGAAGCGAGGGAGGG - Intergenic
1174344662 20:49921396-49921418 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1174478099 20:50811532-50811554 CATGGAGTGGCAGGGAGAGGAGG - Intronic
1174645298 20:52080232-52080254 CAGGGGGTGGGGGAGACAGAGGG + Intronic
1174761821 20:53214252-53214274 ACGGGGGTGGCAGGGGGAGAGGG + Intronic
1174795335 20:53517653-53517675 CCGGGGGTGGCGGGGAGAGGTGG - Intergenic
1174796488 20:53526918-53526940 CAGGGGGTGGGAGGGGGAGGTGG + Intergenic
1174823059 20:53744122-53744144 AAGGGGGAGGGAGAGAGAGAGGG - Intergenic
1174934807 20:54855765-54855787 CAGGGGCTGAGAGAGTGAGATGG + Intergenic
1175032546 20:55970211-55970233 CAGAGGGAGGGAGGGAGAGAGGG - Intergenic
1175268017 20:57714270-57714292 CCGGGGGTGGCAGGCAGACAGGG - Intergenic
1175356844 20:58375368-58375390 AAGGAGATGGCAGAGAGAGAAGG - Intergenic
1175486274 20:59348864-59348886 CAAGAGGTGGCAGAGACAGAAGG + Intergenic
1175515156 20:59564887-59564909 CAGAGGGAGACAGAGACAGATGG + Intergenic
1175530380 20:59670860-59670882 CAGGAGATGGCAGTGAGAGTGGG - Intronic
1175562488 20:59941909-59941931 CAGGGAGAGAGAGAGAGAGATGG + Intronic
1175697115 20:61110955-61110977 CAGAAAGTGGGAGAGAGAGAGGG + Intergenic
1175748096 20:61475559-61475581 CAGGGGGAGAGAGAGAGAGAGGG - Intronic
1175791750 20:61744404-61744426 GAGGTGGAGGGAGAGAGAGAAGG + Intronic
1175791766 20:61744480-61744502 GAGGTGGAGGGAGAGAGAGAAGG + Intronic
1175791783 20:61744557-61744579 GAGGTGGAGGGAGAGAGAGAAGG + Intronic
1175921372 20:62451931-62451953 GAGGGGGAGGGAGAGAGGGAGGG + Intergenic
1175950145 20:62579084-62579106 CAGAGGGAGGCAGGGACAGAGGG - Intergenic
1175960668 20:62634768-62634790 TGGGGGGTGGCAGAGAGGGAGGG + Intergenic
1175968020 20:62669328-62669350 CAGGAGGTGGGAGAGGGAGCAGG - Intronic
1176047784 20:63101648-63101670 GAGGGAGAGGGAGAGAGAGAGGG - Intergenic
1176060890 20:63172495-63172517 CAGGGGGGGGCACAGAGACTGGG + Intergenic
1176383977 21:6127842-6127864 GAGAGGGAGGCAGAGAGGGAGGG + Intergenic
1176808805 21:13516636-13516658 GAGTGGGGGGAAGAGAGAGAAGG + Intergenic
1177257457 21:18683868-18683890 CAGGGTGTGGAAGAGGGAGGAGG + Intergenic
1178371224 21:32029090-32029112 TCGGGGGTGGCAGAGACAGAAGG - Intronic
1178471013 21:32893007-32893029 AAGGGGGAGACAGAAAGAGAGGG - Intergenic
1179224218 21:39439126-39439148 CAGGAGGGGTCAGAGTGAGAAGG + Intronic
1179253159 21:39691099-39691121 CAGGGGCCAGAAGAGAGAGAAGG - Intergenic
1179739497 21:43410396-43410418 GAGAGGGAGGCAGAGAGGGAGGG - Intergenic
1179955697 21:44737047-44737069 GAGGGGAAAGCAGAGAGAGATGG + Intergenic
1180155549 21:45975530-45975552 GAGGGGGTGGCTGAGAGACCTGG + Intergenic
1180231996 21:46432185-46432207 GAGGAAGTGGCAGAGAGACAAGG + Exonic
1180338478 22:11599872-11599894 CAGAGGGAAGCAGGGAGAGAGGG - Intergenic
1180725557 22:17944346-17944368 GAGGGGGTGGCAGTAGGAGAGGG + Intronic
1180758457 22:18180348-18180370 CAGGTGGTGGCTGGGTGAGAAGG + Intergenic
1180768745 22:18364140-18364162 CAGGTGGTGGCTGGGTGAGAAGG + Intergenic
1180777567 22:18498255-18498277 CAGGTGGTGGCTGGGTGAGAAGG - Intergenic
1180810290 22:18755565-18755587 CAGGTGGTGGCTGGGTGAGAAGG - Intergenic
1180826619 22:18867364-18867386 CAGGTGGTGGCTGGGTGAGAAGG + Intergenic
1181035050 22:20165792-20165814 CAGGCGGTGCCAGCGAGAGTGGG + Intergenic
1181151276 22:20885236-20885258 CAGGGGGTGGGAGACTGACAGGG - Intronic
1181196432 22:21189817-21189839 CAGGTGGTGGCTGGGTGAGAAGG - Intergenic
1181213095 22:21303307-21303329 CAGGTGGTGGCTGGGTGAGAAGG + Intergenic
1181294826 22:21828505-21828527 CAGGGGTCGTCAGGGAGAGAGGG + Intronic
1181323015 22:22023108-22023130 GAGGGTGTGGCAGTGAGAGCGGG + Intergenic
1181508771 22:23379567-23379589 CAGGCGGTGCCAGCGAGAGTGGG - Intergenic
1181523734 22:23466303-23466325 CAGGTGGTGGCTGGGTGAGAAGG + Intergenic
1181585921 22:23853786-23853808 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1181629372 22:24142549-24142571 CAGAGGGATGGAGAGAGAGAAGG - Intronic
1181661772 22:24355799-24355821 CGGGGGGAGGGAGGGAGAGAAGG - Intronic
1181986013 22:26800284-26800306 GAGAGGGTGCAAGAGAGAGATGG - Intergenic
1182235369 22:28871083-28871105 CAGCAGGAGGAAGAGAGAGAGGG - Intergenic
1182399654 22:30066059-30066081 CAGAGGGAGGGAGAGGGAGAGGG - Intergenic
1182547976 22:31086515-31086537 CAGGAGGAGGGAGAGAGACAAGG - Intronic
1182617025 22:31594006-31594028 CAGGGAGAGGGAGAGGGAGAGGG + Intronic
1182833013 22:33319079-33319101 CGGGGAGTGGGGGAGAGAGAAGG - Intronic
1182839758 22:33379405-33379427 CATGGGGTGGGGGAGAGAGGAGG - Intronic
1183069739 22:35387763-35387785 CAGGGGGTGGCAGAGAGAGAAGG - Intronic
1183228517 22:36566265-36566287 GAGGGCCTGGCAGAGAGAGATGG - Intronic
1183302666 22:37065972-37065994 CGGGGGGTGGGGGAGAGAGCAGG - Exonic
1183381272 22:37491656-37491678 GAGGGGGAGGGAGAGAGAGGGGG + Intronic
1183382292 22:37496262-37496284 CAGAGGGAGGCATAGAGAAAGGG + Intronic
1183489750 22:38110099-38110121 CAGAGAGAGGGAGAGAGAGAGGG + Intronic
1183685701 22:39360229-39360251 CTGAGGGTGGAGGAGAGAGAGGG - Intronic
1183727076 22:39596125-39596147 CAGGGCAGGGCGGAGAGAGATGG + Intronic
1183736247 22:39646443-39646465 GAGAGGGAGGCAGAGGGAGATGG - Intronic
1183737793 22:39653515-39653537 AAGGGGGGTGCAGGGAGAGAAGG + Intronic
1184116457 22:42425558-42425580 CAGGAGGCGGCAGACAGGGAGGG - Intronic
1184206526 22:43007501-43007523 CAAGGAGTGGCTGGGAGAGAGGG - Intronic
1184281701 22:43441069-43441091 CAGTGGCTGGATGAGAGAGATGG - Intronic
1184322457 22:43752887-43752909 CAGCTGGTGGCAGATAAAGACGG + Intronic
1184482086 22:44753638-44753660 CAGGGTGTGGCAGAGCCCGAGGG - Intronic
1184669948 22:46007208-46007230 CAGGGCCTGGCAGGGAGAGGGGG + Intergenic
1184766690 22:46576160-46576182 GAGGGGGAGGCAGAGAGGGCTGG + Intronic
1184851518 22:47124102-47124124 GTGGGAGCGGCAGAGAGAGAAGG + Intronic
1184857693 22:47155491-47155513 CTGGGAGTGGGAGAGAGGGAGGG + Intronic
1184900677 22:47444708-47444730 CACGGGGAAGCAGGGAGAGAGGG - Intergenic
1184922260 22:47613989-47614011 CAGGAGGAGGCAGAAAGACACGG + Intergenic
1185310295 22:50150547-50150569 CAGGGGGAAGCGGGGAGAGACGG + Intronic
1185374107 22:50474458-50474480 CTGGTGGCGGCAGGGAGAGAAGG - Intronic
1203230366 22_KI270731v1_random:105024-105046 CAGGTGGTGGCTGGGTGAGAAGG + Intergenic
1203276762 22_KI270734v1_random:93274-93296 CAGGTGGTGGCTGGGTGAGAAGG + Intergenic
949829066 3:8195421-8195443 GAGGAGGAGGCAGAGAGATAGGG - Intergenic
949928721 3:9061504-9061526 CAGGGGTGGGCAGAGGGAGTGGG - Intronic
950025247 3:9815754-9815776 CAGGCGGTGGCAGCGTGAGAAGG - Intronic
950097489 3:10338408-10338430 GAGCGGGTGTCAGGGAGAGAAGG - Intronic
950173493 3:10855397-10855419 CAGGGTGTGGCAGAAACAAAAGG - Intronic
950362893 3:12462374-12462396 CCGGTGGTGGCAGGGAGAGGAGG - Intergenic
950464205 3:13143664-13143686 CTGGTAGTGGCAGGGAGAGAAGG + Intergenic
950686916 3:14625126-14625148 CAGGGGGAGGAAGAGAGGGAGGG + Intergenic
950794058 3:15496267-15496289 CAGGGGAGGGCAGAAATAGATGG - Intronic
951069701 3:18312689-18312711 CGGAGGGAGGGAGAGAGAGAGGG + Intronic
951638953 3:24812383-24812405 AAAGGGGTGGGAGGGAGAGAGGG + Intergenic
952646224 3:35662515-35662537 CAGGACTGGGCAGAGAGAGAAGG + Intronic
952773519 3:37022968-37022990 CTGCTGGTGGCAGGGAGAGAAGG - Intronic
952867342 3:37862470-37862492 CAGGGGCTGGCGGAGAGACTGGG + Intronic
952883957 3:38001676-38001698 CAGGTGGGGGCAGTGAGTGAGGG - Intronic
952970136 3:38645525-38645547 CTGGGGGTGGCAGGCAGAAAGGG - Intronic
953156885 3:40383708-40383730 AAGATGGTGGCTGAGAGAGAAGG + Intergenic
953236818 3:41114148-41114170 AAGGAGGTGGCATAGGGAGAAGG + Intergenic
953344771 3:42165987-42166009 CTGGGGATGGCAGAGGGACACGG - Intronic
953375483 3:42424646-42424668 AAGGTGGGGGCAGAGGGAGAAGG + Intergenic
953422656 3:42766348-42766370 GAGGAGGTGGGAGAGAGGGAAGG + Intronic
953424259 3:42780168-42780190 CAGGGGATGACAGCGGGAGATGG + Intronic
953725786 3:45397250-45397272 CTGGGGGTGGAAAAGAGAGAAGG - Intronic
953965276 3:47300062-47300084 CAGGGAGTGAGAAAGAGAGAGGG - Intronic
954219083 3:49141724-49141746 CTGGTGCAGGCAGAGAGAGATGG - Intergenic
954424555 3:50436474-50436496 CAGGGGGCTGCAGAGTGAGTGGG + Intronic
954443565 3:50534695-50534717 CAGGGGTTGGCTGAGCAAGAGGG - Intergenic
954959613 3:54552430-54552452 CAGGGGGTGGGAGAAAGCAATGG - Intronic
955148058 3:56339667-56339689 CAGGGGTGGGAAGAGGGAGAGGG - Intronic
955183192 3:56690953-56690975 CAGGGGCTAGAAGATAGAGATGG + Intergenic
955210532 3:56936276-56936298 CAAGTGAAGGCAGAGAGAGAAGG + Intronic
955521918 3:59783536-59783558 CTGGTGATGGCAGAGAGAGAGGG - Intronic
956026980 3:64993462-64993484 CAGGGGGTGGGAGTTGGAGAGGG + Intergenic
956205923 3:66754684-66754706 ATGTGGCTGGCAGAGAGAGAAGG - Intergenic
956217347 3:66862014-66862036 CATAGGTTGGAAGAGAGAGAAGG - Intergenic
956690534 3:71874221-71874243 CAGGGGCTGGAGGAGAGGGAAGG + Intergenic
956957028 3:74352989-74353011 CAGTGGAAGGCTGAGAGAGATGG + Intronic
957019453 3:75108571-75108593 CAGCAGGAGGAAGAGAGAGAAGG + Intergenic
957264153 3:77939676-77939698 CAGTGTGTGTCAGAGAGACAGGG + Intergenic
957416962 3:79917552-79917574 GAGGGAGTGGGAGGGAGAGAGGG + Intergenic
959270008 3:104194844-104194866 CAGAGGGTGGCAGAGGAGGAGGG + Intergenic
959415945 3:106075809-106075831 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
959539614 3:107523995-107524017 GAGAGGGAGACAGAGAGAGAGGG + Intronic
959545005 3:107585259-107585281 CAGTGGGTTGAGGAGAGAGAAGG + Intronic
959908782 3:111739664-111739686 CAGGGAGAGGCAGGGAGACAGGG - Intronic
960452383 3:117826455-117826477 GAGGGGGTAGGAGAGAGGGAGGG + Intergenic
960686692 3:120301990-120302012 CAGGGGGAGAGAGAGAGAGTGGG + Intergenic
961158543 3:124701662-124701684 AAGGAGGATGCAGAGAGAGAAGG - Intronic
961222514 3:125212097-125212119 AAGGGGGAGGAAGAGAGCGAGGG + Intronic
961307323 3:125967936-125967958 CGGGGTGTAGCAGAGAAAGATGG + Intergenic
961378163 3:126480846-126480868 CAGAGAGGGGCAGAGACAGAAGG - Intergenic
961387305 3:126529930-126529952 CAGGGGGTGGCAGGGAGCCTGGG + Intronic
961514642 3:127425048-127425070 CAGTGGGAGGCTGAGGGAGAGGG + Intergenic
961676853 3:128572863-128572885 TTGGGGGTGGCAGAGGGAAAAGG - Exonic
961729014 3:128953583-128953605 GAGGGGGAGGGAGAGGGAGAGGG - Intronic
961999938 3:131285279-131285301 CAGGAGTGGGTAGAGAGAGAAGG + Intronic
962071158 3:132034934-132034956 AGGAGGGTGGCAGAAAGAGAAGG + Exonic
962254945 3:133864172-133864194 GCGGGGGTGAGAGAGAGAGAAGG + Intronic
962489829 3:135882403-135882425 CAGGGGGTAGGGGTGAGAGAGGG + Intergenic
962551476 3:136496904-136496926 AAAGGAGTGGGAGAGAGAGAGGG + Intronic
962878625 3:139554914-139554936 GAGGAGGAGGGAGAGAGAGAGGG + Intergenic
963776571 3:149445785-149445807 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
964030133 3:152128804-152128826 CTGGGGGTGGGAGAGAGAGAGGG - Intergenic
964047890 3:152353277-152353299 GAGGCTGTGTCAGAGAGAGATGG + Intronic
964122823 3:153204035-153204057 CTGGGGGTGCCAGATAGAGAAGG - Intergenic
964222914 3:154367324-154367346 CGGGGGGGGGAAGGGAGAGAGGG - Intronic
964734812 3:159906112-159906134 CAGGTGTTGGTAGACAGAGAGGG - Intergenic
964818809 3:160747379-160747401 GGGCGGGGGGCAGAGAGAGAGGG - Intergenic
965519513 3:169658856-169658878 CAGGGGGGTGCCGGGAGAGAGGG + Intronic
965530551 3:169766189-169766211 AAGGGGATGGGAGAGAGAGAAGG - Intergenic
965735026 3:171810480-171810502 CAGCGGGAGGGAGGGAGAGAGGG + Exonic
965800494 3:172488329-172488351 GAGGGGGAGACAGAGAGAGTTGG + Intergenic
965967539 3:174512720-174512742 CAAGAGGTAGCAGAGAAAGAAGG - Intronic
966240193 3:177747573-177747595 CAGGGAGGGGCAGGTAGAGAGGG + Intergenic
966746247 3:183280041-183280063 GAGGGGGTGGCAATGAGACAGGG + Intronic
966916579 3:184587598-184587620 CAGAGAGGGGCAGGGAGAGACGG - Intronic
966923972 3:184632775-184632797 CAGGTGGCGGCAGAGAGCGCCGG - Intronic
966925221 3:184640192-184640214 GACTGGGTGGCAGAGAGAGGTGG + Intronic
966972977 3:185062176-185062198 ATGGGGGAGGCAGAGAGAGAGGG - Intergenic
967006373 3:185386905-185386927 CAGGGGGTGGGAGAGGGAGGAGG + Intronic
967180565 3:186899557-186899579 GTGGGGTTGGGAGAGAGAGAAGG - Intergenic
967233175 3:187360193-187360215 GAAGGGCTGGCAGAGAAAGAGGG + Intergenic
967814759 3:193789196-193789218 CAGTGGGTGGCAGAGGGTGGGGG + Intergenic
967851101 3:194083376-194083398 CAGCGGGCGGAAGAGAGTGAGGG - Intergenic
968225797 3:196971157-196971179 TGGGGGGAGCCAGAGAGAGACGG + Intergenic
968429328 4:546091-546113 CATGGGGAGGCAGAGAAAGATGG - Intergenic
968479825 4:828365-828387 CAGGCAGAGACAGAGAGAGACGG - Intergenic
968638718 4:1698116-1698138 CTGTGGGAGGCAGAGACAGACGG + Intronic
968776295 4:2542760-2542782 CAGGAGGTGGATAAGAGAGAAGG + Intronic
968779957 4:2572894-2572916 ATGGGGGTGAGAGAGAGAGATGG + Intronic
968864922 4:3202625-3202647 CAGGATGTGGCAGAGGAAGAGGG - Intronic
968930395 4:3575825-3575847 CAGTGGGTGGCAGTGACAGGAGG - Intergenic
969122717 4:4921666-4921688 CACGTGGTAGGAGAGAGAGATGG + Intergenic
969354013 4:6614599-6614621 CTGGGGGTGGCAGGCTGAGAGGG - Intronic
969384934 4:6837919-6837941 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
969424192 4:7114438-7114460 CAGGAGATGGCACACAGAGAGGG + Intergenic
969591214 4:8122890-8122912 GAGGGGATGGGAGAGGGAGAGGG + Intronic
969652805 4:8477854-8477876 CAAGGGATGGCAGAGCGAGAGGG + Intronic
969658333 4:8510648-8510670 CAGGGGGTGTCAGGGGAAGAGGG + Intergenic
969668504 4:8575964-8575986 GAGGGGGAGGGAGAGAGAGGGGG - Intronic
969717371 4:8874219-8874241 CTGGGGGTTGCGGAGAGAGCGGG + Intergenic
969842625 4:9893536-9893558 TAGGGGGAGGCAGAGAGGGACGG + Intronic
970332699 4:15002558-15002580 GAGGGGGAGTCAGTGAGAGAGGG - Intergenic
970396886 4:15677409-15677431 TAGGGGTTGGGAGATAGAGAGGG + Intronic
970439852 4:16071327-16071349 CAGGGAGTTTTAGAGAGAGAAGG - Intronic
970696502 4:18684592-18684614 GAGGGGGTCGCAAAGTGAGAAGG + Intergenic
971685955 4:29768520-29768542 CAGAGAGAGACAGAGAGAGAGGG - Intergenic
971882075 4:32389646-32389668 CTTGGGGAGGCAGAGGGAGATGG + Intergenic
972065012 4:34931150-34931172 CAGGGGCTGGTAGATAGAGGAGG + Intergenic
972335892 4:38106965-38106987 AAGGGGGCAGCAGAGGGAGAGGG - Intronic
972551972 4:40142136-40142158 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
972727441 4:41757656-41757678 GAGGGAGAGGGAGAGAGAGAGGG - Intergenic
972931111 4:44072266-44072288 CAGGAGGGGGCAGAGGGAGCAGG + Intergenic
973178071 4:47232841-47232863 CTGGGTGTGGCAGAGGGAGTAGG - Intronic
973260746 4:48160825-48160847 CAGAGGGAGGGAGGGAGAGAGGG + Intronic
973279633 4:48345264-48345286 CAGTGTGTGGCAGGGAGAAAGGG - Intronic
973945183 4:55948428-55948450 TTGGGGGCGGCAGAGAGAGACGG + Intergenic
974000320 4:56505629-56505651 CAGGGGTTCGCAAAGAGGGAAGG - Intronic
974029694 4:56765117-56765139 AAGAGTGAGGCAGAGAGAGAGGG - Intergenic
974076424 4:57172508-57172530 CAGGGAGAGGGAGAGGGAGAGGG - Intergenic
974771140 4:66415157-66415179 CAGGGGGTGGTAGAAGGAGATGG + Intergenic
974794786 4:66734684-66734706 AATAGGGTGGGAGAGAGAGAAGG + Intergenic
974828951 4:67166413-67166435 CAGGGTTTGGCAGCAAGAGAGGG + Intergenic
975195693 4:71520857-71520879 CTAGGGGTGGGAGAGAGAGACGG + Intronic
975254465 4:72216776-72216798 CATGGAGGGGCAGACAGAGAGGG - Intergenic
975637229 4:76462688-76462710 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
976223025 4:82773319-82773341 GAGAGAGAGGCAGAGAGAGAAGG - Intronic
976482611 4:85562577-85562599 CAGGTGGTGGTAGAGAGAAGGGG - Intronic
976550539 4:86389921-86389943 TAGATGGGGGCAGAGAGAGAGGG - Intronic
977542327 4:98331346-98331368 GAGGGAGAGGGAGAGAGAGAGGG + Intronic
977542331 4:98331364-98331386 GAGGGAGAGGGAGAGAGAGAGGG + Intronic
977575816 4:98673227-98673249 CAGAGGGTGGTAGAGCTAGAAGG - Intergenic
977770892 4:100858247-100858269 CAGGGGGTGGAGGAGAGACAGGG + Intronic
977808252 4:101328912-101328934 CAAGGAGAGACAGAGAGAGATGG - Intronic
977982343 4:103339261-103339283 CAAGGGGTCACAGAGAGAGACGG - Intergenic
978229265 4:106378668-106378690 CAGTAGGTGGTGGAGAGAGAGGG - Intergenic
978262617 4:106779103-106779125 CAGGGGTTGGGAAGGAGAGAGGG + Intergenic
978265179 4:106815419-106815441 ACCGGGGAGGCAGAGAGAGAAGG + Intergenic
978324444 4:107536577-107536599 ATGGGGGAGGGAGAGAGAGAGGG - Intergenic
978660762 4:111123639-111123661 GAGGGGGGGAGAGAGAGAGAGGG + Intergenic
978765718 4:112403047-112403069 TAGGGGGTGGGGGAGGGAGAGGG + Intronic
978929602 4:114294772-114294794 CAGGGGTTGAGAGAGAGACATGG + Intergenic
979609794 4:122677375-122677397 CAGCGGGTGGGATGGAGAGAGGG + Intergenic
979641830 4:123017195-123017217 GAGGGAGAGGGAGAGAGAGAGGG + Intronic
980299689 4:130972808-130972830 CAGTGGGTAGAAGGGAGAGATGG + Intergenic
980501289 4:133657603-133657625 CAGGGCTTGATAGAGAGAGAAGG + Intergenic
980970286 4:139560815-139560837 CAGGAAGTGCAAGAGAGAGAGGG + Intronic
981013579 4:139951114-139951136 AAGAGGGAGGGAGAGAGAGAAGG - Intronic
981114707 4:140976312-140976334 CAGATGGTGGCAAGGAGAGATGG - Intronic
981148248 4:141350678-141350700 CAGGGGGTGCAAGGGAAAGAAGG - Intergenic
981437433 4:144741981-144742003 GAGGGGGAGAGAGAGAGAGAAGG - Exonic
981494398 4:145375482-145375504 TAGGGGGCGGGAGAGAGGGAGGG - Intergenic
981895285 4:149791561-149791583 GAGGGGGAGGCAGATAAAGAGGG - Intergenic
981918107 4:150056929-150056951 CAGGAGGAGAGAGAGAGAGAAGG - Intergenic
981919696 4:150074113-150074135 CAGGGTGTGGCAGACAGAGTTGG + Intergenic
981970202 4:150658617-150658639 GAGGGAGAGGCAGAGGGAGAGGG - Intronic
981986396 4:150862527-150862549 CATGGGGTGGGGGAGAGGGAAGG + Intronic
982133612 4:152251770-152251792 CAGGGGTTGAGAGAGGGAGAGGG - Intergenic
982273747 4:153618759-153618781 CAGAGGATCCCAGAGAGAGAAGG - Intronic
982437071 4:155392080-155392102 GAGGGAGAGGCAGAGAGAGAGGG + Intergenic
982672134 4:158333638-158333660 CAGCAGGTGGAAGATAGAGAAGG + Intronic
982877908 4:160671134-160671156 GAGGGCGGGGGAGAGAGAGAGGG - Intergenic
983007375 4:162500704-162500726 CAGGGGATGGCGGAGTGCGAGGG + Intergenic
983196370 4:164811144-164811166 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
984200402 4:176713828-176713850 CAACGGGTGCCAGAGAAAGAGGG + Intronic
984292653 4:177814785-177814807 CAGGGGTTAGGGGAGAGAGAGGG - Intronic
984352427 4:178612879-178612901 CAGCAGGAGGAAGAGAGAGAAGG - Intergenic
984379831 4:178978426-178978448 CAGCAGGGGGCAGAGAAAGATGG + Intergenic
984438955 4:179741329-179741351 CAAGGAGCGGGAGAGAGAGAGGG - Intergenic
984856252 4:184198491-184198513 GAGGTGGTGGCACTGAGAGAAGG + Intronic
984860123 4:184230438-184230460 CGGGGGCTGGCAGGGAGAGAGGG - Intergenic
984961365 4:185101096-185101118 GTGGGGGTGGCAGAGAGGTAAGG + Intergenic
984974544 4:185218950-185218972 GATGGGGTGGCAGAGCAAGAAGG - Intronic
985076097 4:186216451-186216473 CAGGAGGTGGAAGAGATGGAAGG + Intronic
985241268 4:187933081-187933103 CAGGAGTTGGCCCAGAGAGACGG + Intergenic
985585835 5:733535-733557 CTGTGGGTGACAGAGACAGATGG - Intronic
985600256 5:824947-824969 CTGTGGGTGACAGAGACAGATGG - Intronic
986285247 5:6354270-6354292 CAGGCGGAGGCAGTCAGAGAGGG + Intergenic
986306214 5:6518994-6519016 CGGGGGGAGGCAGTGAGAGATGG - Intergenic
986307090 5:6524083-6524105 CAGTGTGTGGCGGAGGGAGAGGG - Intergenic
986311391 5:6553461-6553483 CAGAGGGAGGGAGAGAGGGAGGG + Intergenic
986490753 5:8287000-8287022 GAGAGGGAGGGAGAGAGAGAGGG - Intergenic
986627451 5:9735943-9735965 CAAGGGGTAGCAGAGAAAGCTGG - Intergenic
986823785 5:11498222-11498244 GAGGGGGTGGGGGAGAGTGATGG - Intronic
986867410 5:12006408-12006430 AGGGGGGAGGGAGAGAGAGAGGG - Intergenic
987429965 5:17820811-17820833 GAGGGAGAGACAGAGAGAGAGGG + Intergenic
987791319 5:22571757-22571779 CAGGGAGAGGGAGAGAGACAAGG + Intronic
988102944 5:26705789-26705811 TAGAGGGAGGGAGAGAGAGAGGG + Intergenic
989189915 5:38660583-38660605 CAGGAGGAGAGAGAGAGAGAGGG - Intergenic
989663643 5:43825373-43825395 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
989956062 5:50361528-50361550 GAGGGGGAGAGAGAGAGAGAGGG + Intergenic
990308276 5:54515163-54515185 CAGGGGATGGGAGGGAGGGAGGG + Intergenic
990729088 5:58788663-58788685 CAGTGGGTGGGAGAGAAAGGAGG + Intronic
991935496 5:71795269-71795291 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
992208314 5:74452523-74452545 GAGAGGGAGTCAGAGAGAGAGGG - Intergenic
992353228 5:75952634-75952656 GAGGAGGAGGAAGAGAGAGAAGG - Intergenic
992736636 5:79728370-79728392 CAGGGGGTGGCATACTGAGCTGG + Intronic
993496423 5:88615188-88615210 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
993934501 5:93985365-93985387 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
994236973 5:97374247-97374269 CAGGGGGTGGGGTAGAGGGAAGG + Intergenic
994243914 5:97456713-97456735 CAGAGAGTGGCTGATAGAGAGGG - Intergenic
994662504 5:102670628-102670650 ATGGGGGTGGCAGGGAGAGGAGG + Intergenic
995324299 5:110873146-110873168 CAGGGAGTGCCAGATGGAGAGGG + Intergenic
995697613 5:114898162-114898184 AAGGAGGAGGTAGAGAGAGATGG - Intergenic
995847592 5:116510708-116510730 AAGTGGGTGGGGGAGAGAGAAGG - Intronic
996082092 5:119268111-119268133 CGGGGGGCGGCAGAGAGCGAGGG + Intergenic
996318531 5:122188415-122188437 CAAAGGGTGGGTGAGAGAGATGG + Intergenic
996731909 5:126724945-126724967 CTGGGGGAGGCAGACAGAGCTGG - Intergenic
996752012 5:126898034-126898056 CTGGGGGTGGGGGACAGAGAAGG + Intronic
996847771 5:127919797-127919819 CAGAGGGACACAGAGAGAGATGG - Intergenic
997020572 5:129995931-129995953 GAGGGAGAGGAAGAGAGAGATGG - Intronic
997270008 5:132528472-132528494 CAGGAAGTGCCAGGGAGAGAGGG - Intergenic
997304927 5:132830092-132830114 CAGGGGGCGGCAGAGACACGCGG + Intronic
997403503 5:133622039-133622061 AGGGGGGAGGGAGAGAGAGAAGG - Intergenic
997463004 5:134067682-134067704 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
997636125 5:135408503-135408525 CAGGGAGAGGGAGAGGGAGAGGG - Intergenic
997901220 5:137766698-137766720 GAGGGAGAGACAGAGAGAGAGGG + Intergenic
997953911 5:138263823-138263845 CAGGAGATGTAAGAGAGAGAAGG - Intronic
998011578 5:138699634-138699656 CAGAGGGAGGCAGAGAGCAAAGG + Intronic
998106517 5:139472504-139472526 AGGAGAGTGGCAGAGAGAGAGGG - Intergenic
998158865 5:139801878-139801900 CATGGGGCAGGAGAGAGAGAGGG - Intronic
998217310 5:140247001-140247023 AAGGGGGTGGAGGTGAGAGAAGG - Intronic
998258465 5:140609083-140609105 CATGGGGTGGCACAGAGCCATGG - Intergenic
998581719 5:143384113-143384135 GAGGAGGAGACAGAGAGAGAAGG + Intronic
999354121 5:150907610-150907632 GAGGGGTTGGAGGAGAGAGAGGG + Intergenic
999437836 5:151577892-151577914 CCTGGGGTGGCAGGGAGGGAAGG + Intergenic
999727897 5:154452239-154452261 CAGGGAGGGGCAGAGGGAAAGGG - Intronic
999812354 5:155139798-155139820 CAGGTGGTGCCAGAGACAGTTGG + Intergenic
999871820 5:155759335-155759357 AAGGTGGTGAGAGAGAGAGAAGG - Intergenic
999982905 5:156975056-156975078 CGGGAGGGGGAAGAGAGAGAGGG + Intergenic
1000635958 5:163643890-163643912 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
1000879557 5:166681697-166681719 CAGGGAATGAGAGAGAGAGAGGG + Intergenic
1000940925 5:167358936-167358958 CAGGGTGTGGTAGAAACAGAGGG - Intronic
1001078095 5:168644447-168644469 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1001078105 5:168644477-168644499 CAGGGAGAGGGAGAGGGAGAGGG + Intergenic
1001094093 5:168762757-168762779 GTGGGGGTGGGAGACAGAGATGG + Intronic
1001373037 5:171225717-171225739 CAGGGCGGTGCAGAGAGGGAAGG + Intronic
1001460255 5:171905869-171905891 GAGGGGGTGGTGGTGAGAGATGG - Intronic
1001681800 5:173563339-173563361 GAGGGGGTGGGGGATAGAGATGG + Intergenic
1001845499 5:174917798-174917820 CTGGGGGAGGCAGAGAGGGCAGG - Intergenic
1001850688 5:174962301-174962323 CTGGGGGTGGCAGAGATCAATGG - Intergenic
1001892706 5:175352534-175352556 CAGGGCGTGGCCCAGAGAGTTGG - Intergenic
1002026824 5:176401422-176401444 CATGGGCTGGCACAGAGAAAGGG - Intronic
1002096557 5:176834744-176834766 CAGGGAAAGGGAGAGAGAGAGGG - Intronic
1002201167 5:177529262-177529284 CACGGGCTGGCAGTGGGAGAAGG + Intronic
1002261396 5:177996025-177996047 CAGAGGGTGGCATACACAGAGGG - Exonic
1002691957 5:181056027-181056049 GAGGAGGAGTCAGAGAGAGATGG - Intronic
1002894594 6:1369440-1369462 AAGGGGGAGGAGGAGAGAGAAGG + Intergenic
1002979373 6:2120918-2120940 CTGGAGGTGGCAGAGTGACATGG - Intronic
1003016098 6:2468582-2468604 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
1003233804 6:4277926-4277948 GAGGGGGAGGGAGAGAGGGAGGG - Intergenic
1003313350 6:4987900-4987922 CAGGGGGTGGAAGGGAATGAGGG - Intergenic
1003513473 6:6800497-6800519 CAGAGGGAAACAGAGAGAGATGG - Intergenic
1003924391 6:10863076-10863098 CATTGAGTGGCAGAGAAAGAGGG + Intronic
1004337555 6:14777995-14778017 CTGGGGGTGGGAGAGAATGAAGG + Intergenic
1004761541 6:18672161-18672183 CAGGGGGACAGAGAGAGAGAGGG + Intergenic
1004764648 6:18712433-18712455 CAGGAGGTGAAGGAGAGAGAAGG - Intergenic
1004887832 6:20068943-20068965 CAGGGGCTGGGAGGGAGGGAAGG - Intergenic
1005223919 6:23619989-23620011 GAGAGGGGGGGAGAGAGAGAGGG + Intergenic
1005680259 6:28199644-28199666 CATGGTGTGGCAGAGATAAAGGG - Intergenic
1005865172 6:29932035-29932057 GAGGGAGAGGCAGAGGGAGAGGG - Intergenic
1005959323 6:30684710-30684732 CTGGGGGTGGGGGAGACAGAGGG + Exonic
1006006617 6:31007583-31007605 CAGGGTGAGGTTGAGAGAGATGG + Intergenic
1006014434 6:31068294-31068316 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1006034848 6:31202979-31203001 CAGGGGGTGGGAGGGAGAATGGG + Exonic
1006067720 6:31474427-31474449 CTGGGGGTGGCAGAGTAGGATGG + Intergenic
1006078235 6:31548087-31548109 CAGGGGATGTCAGAGATGGAGGG + Intronic
1006154161 6:32005350-32005372 GGTGGGGTGGCAGAGGGAGAGGG + Intergenic
1006160468 6:32038085-32038107 GGTGGGGTGGCAGAGGGAGAGGG + Intergenic
1006192873 6:32220363-32220385 CAGGAGGTGGGAGGTAGAGAAGG - Intronic
1006193680 6:32224160-32224182 CAGGGGTTGTCAGGGACAGAAGG - Intergenic
1006402517 6:33826070-33826092 GAGGAGGGGGCAGAGAAAGAAGG - Intergenic
1006513141 6:34532383-34532405 CAGGGAGGGGCTCAGAGAGAAGG - Intronic
1006546439 6:34785681-34785703 GAGGGAGAGGGAGAGAGAGAGGG - Intergenic
1006730408 6:36231759-36231781 GAGGGGGTTGAAGAGAAAGAAGG - Exonic
1006944762 6:37777917-37777939 GAGGGGGTGGTAGAAGGAGAAGG + Intergenic
1007070872 6:39037364-39037386 CAGAGAGAGGCAAAGAGAGAGGG - Intergenic
1007070877 6:39037425-39037447 CAGGGTTGGGGAGAGAGAGAGGG - Intergenic
1007125631 6:39423361-39423383 AAGGAGGTGCCAGAGAGAGGGGG - Intronic
1007381783 6:41494926-41494948 CGGGGGGAGGCAGAGGGGGAAGG + Intergenic
1007423637 6:41734224-41734246 CAGGGGCTGGCGGAGAGCGGAGG + Intronic
1007636352 6:43302082-43302104 CCGGGGGTTGCAGAGACAGAAGG + Intronic
1007716730 6:43860463-43860485 CAGGGGGTGGGAGTGAGGCAAGG + Intergenic
1007740188 6:44005172-44005194 CAGGGGGAGGGAGAGGGAGGAGG + Exonic
1007774859 6:44219400-44219422 CAGGGGGAGGGGCAGAGAGAAGG + Intergenic
1007835237 6:44668753-44668775 GAGGGAGTGGCAGAGAGGGCTGG + Intergenic
1007854594 6:44842002-44842024 GATGAGGTGACAGAGAGAGATGG + Intronic
1007944902 6:45817398-45817420 AAGAGGGAGGGAGAGAGAGAAGG + Intergenic
1008130875 6:47719302-47719324 CAGGGAGAGGGAGAGAGAGGTGG + Intronic
1009895830 6:69747224-69747246 GAGAGGGTGGAGGAGAGAGAAGG - Intronic
1009928661 6:70149989-70150011 CAGGGAGTTCCAGGGAGAGATGG + Exonic
1010532981 6:76990306-76990328 CAGGGTGTGACAGAGAGTGAAGG - Intergenic
1011410216 6:87059711-87059733 GAGGGGGAGGCAGGGTGAGAGGG + Intergenic
1012581545 6:100876016-100876038 CAGGGGAGAGCAAAGAGAGAAGG + Intronic
1013224490 6:108110668-108110690 CATCGGGTGACAGAGAGAGTGGG + Intronic
1013530964 6:111018209-111018231 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
1013841588 6:114402054-114402076 CATGGTGTGGAAGAGAGAAAAGG + Intergenic
1013880432 6:114892822-114892844 GTGGGGGTGGGAGAGAGGGAGGG + Intergenic
1013893094 6:115049509-115049531 GAGAGAGAGGCAGAGAGAGAAGG + Intergenic
1014069317 6:117162557-117162579 CTGGGTGGGGCAGAGAAAGAAGG + Intergenic
1015034794 6:128640770-128640792 CAGGGAGAGAAAGAGAGAGAGGG + Intergenic
1015335879 6:132037622-132037644 GAGGGGGAGAGAGAGAGAGAAGG + Intergenic
1015480413 6:133702276-133702298 TTGGGGGAGGCAGAGAGGGAGGG - Intergenic
1015890109 6:137962170-137962192 AAGGGAGGGGCAGAGAAAGAAGG - Intergenic
1015920374 6:138260112-138260134 GAGGGGGCGAGAGAGAGAGAGGG + Intronic
1015944930 6:138489932-138489954 CAGGGGGAGAGAGGGAGAGAAGG + Intronic
1016203971 6:141450901-141450923 CCAGGGGTGGCAGAGGGGGAAGG + Intergenic
1016868266 6:148790870-148790892 CAGGAACGGGCAGAGAGAGAAGG - Intronic
1017259658 6:152371651-152371673 AAGAGGAAGGCAGAGAGAGAGGG + Intronic
1017649610 6:156568876-156568898 CAGGGATGGGCAGATAGAGAGGG - Intergenic
1017708018 6:157142191-157142213 CAGGGGGTGGCATGGGGATAAGG + Intronic
1017712188 6:157180914-157180936 CATGGGTGGGCAGAGGGAGAGGG - Intronic
1018239293 6:161756579-161756601 TAGGGGGAGAGAGAGAGAGAAGG - Intronic
1018298617 6:162376731-162376753 GAGGGAGTGGGAGAGGGAGACGG + Intronic
1018341955 6:162860067-162860089 GTGGGGGTGGGGGAGAGAGAAGG + Intronic
1018390307 6:163336508-163336530 CTGGGGGTGGGAGGGAGAGGAGG - Intergenic
1018597289 6:165495313-165495335 CAGGAGGGGAAAGAGAGAGAAGG + Intronic
1018631594 6:165826849-165826871 CAGGAGGTGGCACTGAGGGAGGG + Intronic
1018740156 6:166722392-166722414 CAGGGGGTGGGAGGCACAGAGGG + Intronic
1018993465 6:168692527-168692549 CGGGAGGTGACAGAGGGAGAAGG - Intergenic
1019125596 6:169838433-169838455 CAGAGGGTGACAGAGGGAGATGG - Intergenic
1019158185 6:170052761-170052783 GAGGGGGAGGGAGAGAGGGAGGG - Intergenic
1019158236 6:170052862-170052884 GAGGGGGAGGGAGAGAGGGAGGG - Intergenic
1019341650 7:511373-511395 CTGGGGGTGGCAGGGGCAGAGGG + Intronic
1019459322 7:1147980-1148002 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1019532600 7:1511175-1511197 CAGGGGGTGGTAGAGAAAGTGGG - Intergenic
1019715208 7:2535339-2535361 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1019887270 7:3916143-3916165 CGGGGGGTGGGAAAGAGGGAGGG + Intronic
1019919980 7:4157319-4157341 CGGGAGGTGGAAGGGAGAGAAGG + Intronic
1020011504 7:4808052-4808074 CAGAGGGAGGGAGGGAGAGAAGG - Intronic
1020154942 7:5715259-5715281 TGGGGGGTGGCAGAGAGATGAGG - Intronic
1020512316 7:9073274-9073296 GAGGGAGAGGGAGAGAGAGAGGG - Intergenic
1020726525 7:11821682-11821704 CAGGGGACGTCAGAGAGAGATGG - Intronic
1020914482 7:14175419-14175441 CAGGAGGTGGAGGAGAGAAAGGG - Intronic
1021192785 7:17641799-17641821 CAGGTGGTGACAGGCAGAGACGG - Intergenic
1021391922 7:20103329-20103351 GAGGGGAAGGCAGAGATAGAGGG + Intergenic
1021510638 7:21428520-21428542 CAGGGGGTGGGGGAGAAGGAGGG - Intronic
1021847816 7:24779723-24779745 CTGAGGATGGCAGCGAGAGATGG - Intergenic
1021886658 7:25146219-25146241 CAGGGCTTGGGAAAGAGAGACGG + Intronic
1021972693 7:25981169-25981191 GAGGGGGTGGAAGAAGGAGAAGG + Intergenic
1022063193 7:26822509-26822531 CAAGGAGAGGCAGAGAGATAGGG - Intronic
1022127807 7:27375112-27375134 GAGGAGGGGGAAGAGAGAGAAGG + Intergenic
1022533080 7:31079127-31079149 CAGGGGGTGTCTGAGGGAAAGGG + Intronic
1022634470 7:32119089-32119111 CAGTGGGAGAGAGAGAGAGAAGG - Intronic
1022830854 7:34065248-34065270 CATGGGGAGAGAGAGAGAGAGGG - Intronic
1022998632 7:35784805-35784827 CATGGAGGGGCAGAAAGAGAGGG - Intergenic
1023012721 7:35938075-35938097 TGGGGGGTGGCAGAGAGGCAGGG + Intergenic
1023606506 7:41936282-41936304 CAGGTGGTAGGGGAGAGAGATGG + Intergenic
1023863237 7:44227486-44227508 CAGGGGGTGGAGGACAGAGGAGG + Intronic
1024022594 7:45385659-45385681 CTGGGGCAGGCAGAGGGAGATGG + Intergenic
1024022706 7:45386343-45386365 CATGGGATGACATAGAGAGAAGG + Intergenic
1024078409 7:45835772-45835794 TGGGGGGTGGCAGAGAGGCAGGG - Intergenic
1024229997 7:47356446-47356468 CAGAGGGTGGCAGATTGAGTTGG - Intronic
1024621159 7:51158856-51158878 CACGGGGTGGGAGACAGGGAAGG + Intronic
1024654231 7:51435488-51435510 TAGGGGTGGGAAGAGAGAGAGGG - Intergenic
1024847324 7:53662025-53662047 CAGAGGATGACAGAGACAGATGG - Intergenic
1024957036 7:54933263-54933285 CAGCTGGTGGCAGAGAGGGAGGG + Intergenic
1024989401 7:55221213-55221235 GAGGGGGAGGGAGAGGGAGAGGG + Intronic
1024993308 7:55253052-55253074 GAGGGGGTGGTGGGGAGAGAGGG - Intronic
1026087454 7:67274243-67274265 CTGGGGGAGGCAGAGACAGGCGG - Intergenic
1026124583 7:67568476-67568498 CACGGGGTGGAATTGAGAGAGGG - Intergenic
1026277749 7:68895023-68895045 GAGGGAGAGGGAGAGAGAGAAGG - Intergenic
1026534941 7:71231718-71231740 GTGGGGGAGGGAGAGAGAGAGGG + Intronic
1026976125 7:74499432-74499454 GTGGGGGAGGGAGAGAGAGAAGG + Intronic
1027126026 7:75557368-75557390 ACATGGGTGGCAGAGAGAGAGGG - Intronic
1027647678 7:80824495-80824517 CAAAGGCTGGAAGAGAGAGAGGG + Intronic
1028039789 7:86037355-86037377 CAGGGGGTGGGGGAAGGAGAGGG - Intergenic
1028535457 7:91886844-91886866 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1028535459 7:91886850-91886872 CAGGGGGAGGGGGAGGGAGAGGG - Intergenic
1029514392 7:101016741-101016763 GAGTGGGTGGGAGAGGGAGAGGG + Intronic
1029552740 7:101246184-101246206 CAGGGCTTGGCAGAGAGTGAGGG + Intronic
1029694833 7:102205713-102205735 CAGGTGGTGGCGGAGAGTGGTGG + Intronic
1030362977 7:108614741-108614763 CAGGGAGGGAGAGAGAGAGAGGG + Intergenic
1030375457 7:108748127-108748149 CAAGGGATGGGAGAGAGTGAAGG + Intergenic
1030638249 7:111974549-111974571 ATGGGGGTTGCAGAGAGAGGAGG + Intronic
1030999461 7:116398038-116398060 CAGTGAGAGACAGAGAGAGAAGG - Intronic
1031219443 7:118945927-118945949 CAGTGGGTGGGAGAGGCAGAAGG - Intergenic
1031448151 7:121880424-121880446 AAGGGGAAGGCAGAGAGAGAGGG - Intronic
1031502691 7:122539739-122539761 CAGAGAGAGACAGAGAGAGAGGG - Intronic
1032355101 7:131203762-131203784 CAGGGAGAGACAGAGAGAGTGGG - Intronic
1032450597 7:132027085-132027107 CAAGGGATGGAAGAGTGAGAAGG + Intergenic
1032537654 7:132678135-132678157 CAGGAGGCAGCAGGGAGAGAAGG - Intronic
1032587165 7:133157437-133157459 CAAGGAGAGGCAGAGAGAGCTGG - Intergenic
1032770295 7:135046476-135046498 CAGGGGTTAGTAGGGAGAGATGG - Intronic
1032848232 7:135770138-135770160 CAGGGGCTGCAGGAGAGAGACGG + Intergenic
1032948084 7:136874555-136874577 AGAGGGGGGGCAGAGAGAGAGGG - Intronic
1033226161 7:139564055-139564077 CAGGAGGAGGCAGAGACAGAGGG - Exonic
1033248149 7:139736068-139736090 CAGGAGGTGGCTGAGAGGGGAGG + Intronic
1033317695 7:140311634-140311656 GTGGGGGTTGCAGTGAGAGATGG - Intronic
1033630567 7:143153543-143153565 CAGGAGGTGGCAGAAAGCAAAGG + Intergenic
1033820048 7:145124242-145124264 CAGTGGGAGCAAGAGAGAGAGGG + Intergenic
1033979462 7:147146257-147146279 CAGGGCATGGCAGACTGAGAAGG - Intronic
1034459516 7:151190816-151190838 CAGGTGGGGGCACAGAGGGAAGG + Intergenic
1034725996 7:153335851-153335873 CACGGGGTGGGAGGGAGGGAGGG - Intergenic
1034757776 7:153639378-153639400 CTGGAGGTGGTAGAGAGGGATGG - Intergenic
1034895228 7:154872191-154872213 CAGGGAGAGGAAGAGATAGAGGG - Intronic
1034922790 7:155097431-155097453 GAGGGAGTGGGAGAGGGAGAGGG + Intergenic
1035470676 7:159106857-159106879 CAGGGAGGGGCAGAGAGATCAGG + Intronic
1035555193 8:562551-562573 CAGGGGGTCTCACAGAGAGCTGG + Intergenic
1035607780 8:940370-940392 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
1035743276 8:1944748-1944770 GAGGGGGTGACAGAGGGTGAGGG - Intronic
1036121318 8:6020747-6020769 GAGAGAGAGGCAGAGAGAGAGGG - Intergenic
1036195001 8:6706642-6706664 CGGGTAGTGGCAGAAAGAGAGGG + Intergenic
1036490326 8:9219231-9219253 CAGGGGAGGCCAAAGAGAGATGG + Intergenic
1036582324 8:10086868-10086890 GAGGGAGAGGGAGAGAGAGAGGG + Intronic
1036640473 8:10580282-10580304 AGGGGGATGGGAGAGAGAGAGGG - Intergenic
1036684839 8:10902802-10902824 CTGTTGCTGGCAGAGAGAGAGGG - Intronic
1036685267 8:10905212-10905234 CAGGTGGTGGGAGAGTGAGGAGG - Intronic
1037632396 8:20670138-20670160 GAGGGGGTGTCATAGAGAGCTGG + Intergenic
1037756456 8:21713076-21713098 GAGGGAGAGGCAGAGGGAGAGGG + Intronic
1037977616 8:23224687-23224709 CGGGAGGGGGCAGAGAGAGAGGG - Intronic
1038121294 8:24619243-24619265 CAGGGGTTGGTAGAGAGAGACGG + Intergenic
1038193953 8:25349111-25349133 CAGAGGGAAGCAGAGAGGGAGGG + Intronic
1038407149 8:27330624-27330646 AAGGGGGCGGCAGAGGGGGAGGG + Intronic
1038443670 8:27588404-27588426 CCGGGGGTGGCAGAGGCACAGGG - Intergenic
1039112271 8:34052852-34052874 GAGGGGGAGGAAGAGAGGGAGGG + Intergenic
1039156316 8:34562528-34562550 GAGATGGTGGCAGAGAGTGAGGG - Intergenic
1039382629 8:37100265-37100287 GAGGGGGAGAAAGAGAGAGAGGG - Intergenic
1039472299 8:37821062-37821084 AGGGTGGTGGGAGAGAGAGAGGG - Intronic
1039644205 8:39262671-39262693 GAGGGAGTGAAAGAGAGAGAGGG - Intronic
1039659805 8:39449532-39449554 CTGGGGGTGGTAAAGAGAGCTGG - Intergenic
1039940926 8:42090471-42090493 CAGGGGTTAGCAGAGAGGGAAGG + Intergenic
1040121512 8:43688671-43688693 GAGGGAGTGGGAGAGGGAGAGGG + Intergenic
1040945804 8:52883087-52883109 CAGGGGGAGAGAGAGAAAGAAGG + Intergenic
1041067094 8:54092320-54092342 AAGGAGGAGACAGAGAGAGAAGG + Intronic
1041313583 8:56539991-56540013 CGGGGAGAGGCAGGGAGAGAGGG + Intergenic
1041313590 8:56540047-56540069 CAGAGAGAGGCAGAGAGAGAGGG + Intergenic
1041497870 8:58506990-58507012 CAGGGGGAGGGAGAGAAAGAGGG + Intergenic
1041606797 8:59791785-59791807 TAGGAGGAGGCAGAGAAAGACGG + Intergenic
1041698150 8:60759447-60759469 GAGAGGGAGGGAGAGAGAGAGGG - Intronic
1041845575 8:62323954-62323976 CAGAGGGAGGGAGAGAGGGAAGG + Intronic
1042313285 8:67399658-67399680 CAGGGGTTGCAAGTGAGAGATGG - Intergenic
1042375050 8:68040451-68040473 CAAGGGATGGGAGAAAGAGAAGG - Intronic
1042563309 8:70089847-70089869 CAGCAAGTGTCAGAGAGAGAGGG - Intergenic
1042592815 8:70414266-70414288 CAGGCAGAGGCAGAAAGAGAAGG - Intergenic
1042747184 8:72120501-72120523 CAGCAGGTAGCTGAGAGAGAGGG + Intergenic
1042748712 8:72134874-72134896 CAGGGTGGGGCAGTGGGAGAGGG + Intergenic
1042760425 8:72266485-72266507 CATGGGGAAGGAGAGAGAGAGGG + Intergenic
1043476511 8:80610821-80610843 GAGGGGGTGGAAGATAAAGAAGG - Intergenic
1043504464 8:80888585-80888607 CACAGGGGTGCAGAGAGAGAGGG - Intergenic
1044580245 8:93819282-93819304 CTGGGGGTGGCTGAGGAAGAAGG - Intergenic
1045305063 8:100951417-100951439 GAGGGGGCGGCCGAGGGAGAGGG + Intronic
1045489708 8:102658804-102658826 CAGAGGGTGTCAGGGAGAGTGGG + Intergenic
1045905672 8:107341974-107341996 CAGGGGCAGGGAGAGAGAGTTGG - Intronic
1045992063 8:108319637-108319659 CAGGAGTTGGCAGATGGAGAGGG - Intronic
1046400003 8:113692359-113692381 CAGGGGGAGGCAGAGCAAGATGG - Intergenic
1046859122 8:119070532-119070554 GAGGGAGAGGGAGAGAGAGATGG - Intronic
1046944600 8:119962889-119962911 CAGGGGGTGAGGAAGAGAGAGGG + Intronic
1047005968 8:120620982-120621004 CTGGGGGAGGTAGAGAGAGAGGG - Intronic
1047138524 8:122108153-122108175 GAGAGGGAGGCAGAGAAAGATGG - Intergenic
1047609881 8:126510465-126510487 CAGGGGGAGAAAGAGAGAGAGGG + Intergenic
1048289741 8:133171625-133171647 CAGGGAGAGCCAGAGACAGAAGG + Intergenic
1048451091 8:134534629-134534651 CAGGGGGAGAGAGGGAGAGAGGG + Intronic
1048622055 8:136144524-136144546 CAGGGGAGGACAGGGAGAGATGG - Intergenic
1048977312 8:139680250-139680272 CTGGGGGTGGCAGAGGGGGCAGG + Intronic
1049233244 8:141495035-141495057 CATGAAGTGGCAGAGAGAAATGG - Intergenic
1049241220 8:141538261-141538283 ATGGGGGAGGCAGAGAGTGAGGG - Intergenic
1049241233 8:141538304-141538326 ATGGGGGAGGCAGAGAGTGAGGG - Intergenic
1049276265 8:141721586-141721608 AGGAGGGTGGCAGTGAGAGAGGG - Intergenic
1049343760 8:142127677-142127699 GAGAGGGAGGGAGAGAGAGAGGG + Intergenic
1049538024 8:143191485-143191507 CAGAGGGAGGAAGAGAGAGGAGG + Intergenic
1049687355 8:143944288-143944310 CAGGGGGAGGCTGGGAGGGAGGG - Intronic
1049702004 8:144019582-144019604 CAGGGGCTTGCAGGGAGATAGGG + Intronic
1049845732 8:144800029-144800051 CAGGCGGGGGAACAGAGAGAAGG + Intronic
1050039208 9:1471135-1471157 TAGGAGGTGGCATAGAGAGATGG - Intergenic
1050087378 9:1980164-1980186 AAGGGGAGGGCAGGGAGAGAGGG - Intergenic
1050148947 9:2599941-2599963 AAAGGAGTGGGAGAGAGAGAGGG + Intergenic
1050231660 9:3532305-3532327 AGGGAGGGGGCAGAGAGAGAGGG - Intergenic
1050527757 9:6560916-6560938 CAGAGGGAAGCAGAGGGAGATGG + Intronic
1050579738 9:7040349-7040371 CAGAGTGGGGTAGAGAGAGAGGG - Intronic
1050672801 9:8016787-8016809 CAGAGGGAGCAAGAGAGAGAAGG + Intergenic
1050692236 9:8241027-8241049 GAAGGGGTGACAGAGAGTGAGGG + Intergenic
1051006050 9:12345946-12345968 GAGCGGGAGGAAGAGAGAGAAGG - Intergenic
1052093842 9:24361345-24361367 CAGGGGCTGGTGGAGAAAGAAGG + Intergenic
1053511451 9:38691216-38691238 TAGGAGGGAGCAGAGAGAGAAGG + Intergenic
1053749320 9:41236516-41236538 AAGGGGGGAGGAGAGAGAGAGGG + Intergenic
1054254761 9:62801393-62801415 AAGGGGGGAGGAGAGAGAGAGGG + Intergenic
1054336545 9:63814209-63814231 AAGGGGGGAGGAGAGAGAGAGGG - Intergenic
1054459712 9:65456089-65456111 CAGTGGGTGGCAGTGACAGGAGG + Intergenic
1055342216 9:75296150-75296172 GAGAGGGAGGCAGAGAAAGATGG - Intergenic
1055506496 9:76954828-76954850 CAGGGAGAGGGAGAGGGAGAGGG - Intergenic
1055539685 9:77290486-77290508 CAGGGGGTGGGGGAGAGAAAGGG - Intronic
1056018437 9:82416733-82416755 CAGGTGGTACTAGAGAGAGAAGG + Intergenic
1056336258 9:85573076-85573098 GAGGGGGAGGGAGAGGGAGAGGG - Intronic
1056604702 9:88076843-88076865 GAGACGGAGGCAGAGAGAGACGG - Intergenic
1056784166 9:89577056-89577078 CAGGGGCTGGCAGGCAGGGAAGG - Intergenic
1057125579 9:92613609-92613631 CGGGGGGAGGCAGGGAGTGAGGG - Exonic
1057489958 9:95512789-95512811 CAAGGGGTGCCAGAGGCAGAAGG - Intronic
1057747053 9:97760838-97760860 GAGGGAGAGGGAGAGAGAGAGGG - Intergenic
1057930056 9:99185332-99185354 GAGGCGCTGGCAGGGAGAGAGGG + Intergenic
1058782307 9:108350562-108350584 AAGAGGGAGGCAGAGAGAAAAGG + Intergenic
1058877692 9:109258775-109258797 GAGGGAGAGGCAGAGCGAGAGGG + Intronic
1059023450 9:110599784-110599806 CCGGGAGTGGCACAGAGACAAGG - Intergenic
1059118299 9:111618260-111618282 GAGGGGGAGGGAGAGGGAGAGGG + Intergenic
1059309956 9:113381423-113381445 GAGAGGGAGGGAGAGAGAGAGGG - Intergenic
1059440329 9:114302993-114303015 GAGGGAGTGGCAGTGAGAGCAGG - Intronic
1059813361 9:117882362-117882384 CAGGAGGAGGAAGAGAGAGAAGG - Intergenic
1060266374 9:122113831-122113853 CAGGGGATTGCAGGGAGGGAGGG + Intergenic
1060283233 9:122227681-122227703 CAGGGAGAGGGGGAGAGAGAGGG - Intronic
1060315672 9:122508120-122508142 GAGGGGGGGAGAGAGAGAGAGGG + Intergenic
1060454520 9:123779357-123779379 GAGGAGGACGCAGAGAGAGAAGG - Intronic
1060667480 9:125440587-125440609 CCGGGGGAGGCAGCGCGAGATGG + Intronic
1060789879 9:126478741-126478763 CTGGGGGTGGCAGAGAGGAAGGG - Intronic
1060936223 9:127517741-127517763 CAGGGGGTGGGGTACAGAGATGG - Intronic
1061046092 9:128165958-128165980 CATGTGGTGGCAGAAACAGAAGG - Intergenic
1061096215 9:128458109-128458131 CAGGGGGTGGCAGGGAGGGTGGG - Intronic
1061290371 9:129647357-129647379 CATGGGCTGGGAGAGGGAGAAGG - Intergenic
1061366200 9:130173310-130173332 CCCGGTGTGGCAGACAGAGATGG - Intronic
1061382201 9:130265471-130265493 CCGGGGGCGGGAGAGAGGGAGGG - Intergenic
1061427323 9:130507381-130507403 CAGGGAGAGGGAGAGGGAGAGGG + Intergenic
1061488043 9:130930205-130930227 CAAGGGGAGACAGAGAGACAGGG + Intronic
1061551450 9:131337076-131337098 CTGCGGGTGGCAGAGAGGGGTGG + Intergenic
1061677639 9:132227445-132227467 CATGGGATGGCAGGGAGTGATGG + Intronic
1061704559 9:132442970-132442992 CAGGGGTTGGCAGAGGGGAATGG - Intronic
1061880089 9:133564546-133564568 GAGGGAGAGGGAGAGAGAGAGGG + Intronic
1061880112 9:133564666-133564688 GAGGGAGAGGGAGAGAGAGAGGG + Intronic
1061994705 9:134177531-134177553 CAGGGGGAGGAGGAGAGACACGG - Intergenic
1062085495 9:134645982-134646004 AAGGGGATGGGAGAGAGGGAGGG - Intronic
1062191686 9:135251099-135251121 GAGGGGCTGCCAGAGAGAGCTGG + Intergenic
1062194162 9:135263957-135263979 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1062383475 9:136298782-136298804 CAGGGGCTGGGGGAGAGGGATGG + Intronic
1062428325 9:136516228-136516250 CAGCGGGAGGCAGGGAGAGCTGG - Intronic
1185505236 X:628343-628365 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505246 X:628457-628479 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505249 X:628493-628515 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505257 X:628605-628627 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505260 X:628641-628663 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505264 X:628709-628731 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505271 X:628823-628845 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505274 X:628859-628881 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505284 X:628973-628995 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505294 X:629087-629109 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505297 X:629123-629145 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505305 X:629237-629259 CAGGGAGAGACAGAGAGAGATGG - Intronic
1185505308 X:629273-629295 CAGGGAGAGACGGAGAGAGATGG - Intronic
1185505312 X:629315-629337 CAAGGAGAGACAGAGAGAGATGG - Intronic
1185550082 X:976006-976028 TAAGAGGAGGCAGAGAGAGAAGG + Intergenic
1185688271 X:1948292-1948314 GAGGGGGAGGAGGAGAGAGAAGG + Intergenic
1185688572 X:2133868-2133890 GAGGGGGAGGAGGAGAGAGAAGG + Intergenic
1185755844 X:2652290-2652312 CAGGGGGCAGCAGAGGGAGAAGG + Intergenic
1185769924 X:2758126-2758148 AAGGAGGGGGCAGGGAGAGAGGG - Intronic
1185938952 X:4291959-4291981 TAAGGGGTGGCAGAGGCAGAAGG - Intergenic
1185966827 X:4614953-4614975 GAGAGAGAGGCAGAGAGAGATGG + Intergenic
1186074491 X:5863260-5863282 GAGGAGGAGGAAGAGAGAGAAGG - Intronic
1186088716 X:6021076-6021098 GAGGGGGAGAGAGAGAGAGAGGG - Intronic
1186430080 X:9497772-9497794 GAGAGGGAGGGAGAGAGAGAGGG - Intronic
1186517354 X:10175912-10175934 GAGGGGGAGAGAGAGAGAGAGGG - Intronic
1186635151 X:11395715-11395737 CAAGGGTTAGCAAAGAGAGAAGG + Intronic
1186822818 X:13308669-13308691 CTTGGGGTGGCAGAGGCAGAAGG + Intergenic
1187025846 X:15434458-15434480 CAGGGAGAGGGAGAGGGAGAGGG + Intronic
1187153676 X:16704492-16704514 CAGCGGGTAGGAGGGAGAGAGGG + Intronic
1187460049 X:19478166-19478188 AAGGGGGAGAGAGAGAGAGAGGG + Intronic
1187726623 X:22209783-22209805 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
1189021568 X:37347166-37347188 CAGGGAGAGGGAGAGAAAGAGGG + Intergenic
1189036393 X:37497247-37497269 AATGGCATGGCAGAGAGAGAGGG - Intronic
1189377139 X:40474886-40474908 CAGGGGCAGGAAGAGGGAGAAGG + Intergenic
1189505677 X:41611621-41611643 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
1189505681 X:41611639-41611661 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
1189505685 X:41611657-41611679 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
1189505689 X:41611675-41611697 GAGGGAGAGGGAGAGAGAGAGGG - Intronic
1189623625 X:42871065-42871087 CAGGATGTGGGGGAGAGAGACGG - Intergenic
1189834116 X:45003886-45003908 GAGGGGGTGGAAGGGGGAGAAGG - Intronic
1189913076 X:45830398-45830420 CAGGGGATGACAGAGAGGAAGGG + Intergenic
1190101588 X:47526373-47526395 AAGGGGGGGGGAGAGAGGGAGGG - Intergenic
1190184342 X:48221739-48221761 GAGGGGGAGGGAGAGGGAGAGGG - Intronic
1190576713 X:51846706-51846728 GAGCAGGTGGAAGAGAGAGAGGG + Intronic
1190726191 X:53192501-53192523 CAGGGGAAGGGAGAGGGAGAAGG + Exonic
1191675928 X:63792464-63792486 TAGTGGGTGGCAGAGGCAGATGG + Intergenic
1191835191 X:65456427-65456449 CAGGGAGAGGGAGAGGGAGAGGG - Intronic
1191894370 X:65976085-65976107 CAGGGAGAGGGAGAGGGAGAGGG + Intergenic
1192151051 X:68712629-68712651 CAGGGGGTGGGAGAGTGGGAGGG + Intronic
1192175664 X:68883558-68883580 CAGTGGGTGGGAGAGGGGGAGGG - Intergenic
1192431511 X:71115441-71115463 CAGGGGTTGTCGGAGAGGGAAGG + Intergenic
1192534257 X:71913828-71913850 CAGGGGAGGACAGAGAGAGGAGG + Intergenic
1193509254 X:82379082-82379104 GAGCAGGTGGAAGAGAGAGAGGG + Intergenic
1194788592 X:98118148-98118170 CAGAGAATGGCAGAGAGAGGTGG - Intergenic
1194976888 X:100405547-100405569 GGGGGGGAGGGAGAGAGAGAGGG - Intronic
1195694848 X:107659350-107659372 CAAAGGGAGGCAGAGAGAGGTGG - Intergenic
1196619443 X:117806068-117806090 GAGAGGGAGGCAGAGAAAGATGG + Intergenic
1196778344 X:119361344-119361366 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1196984820 X:121256818-121256840 CAGGAAGTGAGAGAGAGAGATGG - Intergenic
1197489465 X:127100307-127100329 CTGGGAGTGGCACAGAGACAGGG + Intergenic
1197735739 X:129849743-129849765 GAGGGAGAGGGAGAGAGAGAGGG - Intergenic
1198858367 X:141043246-141043268 GAGGGAGAGGGAGAGAGAGAGGG - Intergenic
1198904328 X:141544124-141544146 GAGGGAGAGGGAGAGAGAGAGGG + Intergenic
1198947437 X:142030654-142030676 GAGGGGGAGGGAGAGGGAGAGGG - Intergenic
1199036905 X:143062853-143062875 CATAGGTTGGCAGAGAAAGATGG + Intergenic
1199577084 X:149322820-149322842 CAGAGGGAGACAGTGAGAGATGG - Intergenic
1200326441 X:155245201-155245223 TAGGGGCTGGCGTAGAGAGATGG - Intergenic
1200808059 Y:7452977-7452999 CAGAGAGTGACAAAGAGAGATGG + Intergenic
1201146248 Y:11066969-11066991 GAGAGGGAGGCAGAGGGAGAGGG + Intergenic
1201300597 Y:12501506-12501528 AAGGAGGGGGCAGGGAGAGAGGG + Intergenic
1202232746 Y:22672326-22672348 CAGGGGATGGGAGACAGCGAGGG - Intergenic
1202310410 Y:23523832-23523854 CAGGGGATGGGAGACAGCGAGGG + Intergenic
1202560392 Y:26146762-26146784 CAGGGGATGGGAGACAGCGAGGG - Intergenic