ID: 1183069744

View in Genome Browser
Species Human (GRCh38)
Location 22:35387776-35387798
Sequence CCACCCCCTGGAGGTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183069737_1183069744 13 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1183069744 22:35387776-35387798 CCACCCCCTGGAGGTGCCATGGG No data
1183069738_1183069744 5 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1183069744 22:35387776-35387798 CCACCCCCTGGAGGTGCCATGGG No data
1183069739_1183069744 -10 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG 0: 1
1: 0
2: 13
3: 162
4: 1531
Right 1183069744 22:35387776-35387798 CCACCCCCTGGAGGTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183069744 Original CRISPR CCACCCCCTGGAGGTGCCAT GGG Intronic
No off target data available for this crispr