ID: 1183069744

View in Genome Browser
Species Human (GRCh38)
Location 22:35387776-35387798
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183069738_1183069744 5 Left 1183069738 22:35387748-35387770 CCAGATGTCATAGAGCCTTCTCT No data
Right 1183069744 22:35387776-35387798 CCACCCCCTGGAGGTGCCATGGG No data
1183069737_1183069744 13 Left 1183069737 22:35387740-35387762 CCTTCTAACCAGATGTCATAGAG No data
Right 1183069744 22:35387776-35387798 CCACCCCCTGGAGGTGCCATGGG No data
1183069739_1183069744 -10 Left 1183069739 22:35387763-35387785 CCTTCTCTCTCTGCCACCCCCTG No data
Right 1183069744 22:35387776-35387798 CCACCCCCTGGAGGTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type