ID: 1183077321

View in Genome Browser
Species Human (GRCh38)
Location 22:35435361-35435383
Sequence GGGCCTCGATGGGGACTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183077310_1183077321 4 Left 1183077310 22:35435334-35435356 CCCTGGCTGTCTCTCAGGGCCGC No data
Right 1183077321 22:35435361-35435383 GGGCCTCGATGGGGACTTGGTGG No data
1183077311_1183077321 3 Left 1183077311 22:35435335-35435357 CCTGGCTGTCTCTCAGGGCCGCG No data
Right 1183077321 22:35435361-35435383 GGGCCTCGATGGGGACTTGGTGG No data
1183077306_1183077321 26 Left 1183077306 22:35435312-35435334 CCAGTGTGCAGAGTGACAATGAC No data
Right 1183077321 22:35435361-35435383 GGGCCTCGATGGGGACTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183077321 Original CRISPR GGGCCTCGATGGGGACTTGG TGG Intergenic