ID: 1183078617

View in Genome Browser
Species Human (GRCh38)
Location 22:35442185-35442207
Sequence TGGAGTATAATATACACGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183078617_1183078621 -9 Left 1183078617 22:35442185-35442207 CCACCCGTGTATATTATACTCCA No data
Right 1183078621 22:35442199-35442221 TATACTCCAGTGCCAGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183078617 Original CRISPR TGGAGTATAATATACACGGG TGG (reversed) Intergenic
No off target data available for this crispr