ID: 1183078889

View in Genome Browser
Species Human (GRCh38)
Location 22:35443759-35443781
Sequence CAGGTGCTTGCACTTGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183078885_1183078889 10 Left 1183078885 22:35443726-35443748 CCAGAGGGGATGCTCTTGTGTAT No data
Right 1183078889 22:35443759-35443781 CAGGTGCTTGCACTTGTTTGTGG No data
1183078880_1183078889 26 Left 1183078880 22:35443710-35443732 CCTGCACAGTGGGGGCCCAGAGG No data
Right 1183078889 22:35443759-35443781 CAGGTGCTTGCACTTGTTTGTGG No data
1183078884_1183078889 11 Left 1183078884 22:35443725-35443747 CCCAGAGGGGATGCTCTTGTGTA No data
Right 1183078889 22:35443759-35443781 CAGGTGCTTGCACTTGTTTGTGG No data
1183078879_1183078889 29 Left 1183078879 22:35443707-35443729 CCTCCTGCACAGTGGGGGCCCAG No data
Right 1183078889 22:35443759-35443781 CAGGTGCTTGCACTTGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183078889 Original CRISPR CAGGTGCTTGCACTTGTTTG TGG Intergenic
No off target data available for this crispr