ID: 1183080363

View in Genome Browser
Species Human (GRCh38)
Location 22:35452068-35452090
Sequence TGGTTTTTACACATGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183080363_1183080369 -1 Left 1183080363 22:35452068-35452090 CCCTCATCCATGTGTAAAAACCA No data
Right 1183080369 22:35452090-35452112 AGGCACCCAGAAAACGAGTAGGG No data
1183080363_1183080372 9 Left 1183080363 22:35452068-35452090 CCCTCATCCATGTGTAAAAACCA No data
Right 1183080372 22:35452100-35452122 AAAACGAGTAGGGTGAAACTTGG No data
1183080363_1183080368 -2 Left 1183080363 22:35452068-35452090 CCCTCATCCATGTGTAAAAACCA No data
Right 1183080368 22:35452089-35452111 CAGGCACCCAGAAAACGAGTAGG No data
1183080363_1183080373 29 Left 1183080363 22:35452068-35452090 CCCTCATCCATGTGTAAAAACCA No data
Right 1183080373 22:35452120-35452142 TGGTGCCTGCCTTTACCTGCAGG No data
1183080363_1183080374 30 Left 1183080363 22:35452068-35452090 CCCTCATCCATGTGTAAAAACCA No data
Right 1183080374 22:35452121-35452143 GGTGCCTGCCTTTACCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183080363 Original CRISPR TGGTTTTTACACATGGATGA GGG (reversed) Intergenic
No off target data available for this crispr