ID: 1183080880

View in Genome Browser
Species Human (GRCh38)
Location 22:35455588-35455610
Sequence CAGTCTGAGCCCTGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183080875_1183080880 15 Left 1183080875 22:35455550-35455572 CCCAGAAGAATAATTTTTTTTTA No data
Right 1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG No data
1183080876_1183080880 14 Left 1183080876 22:35455551-35455573 CCAGAAGAATAATTTTTTTTTAA No data
Right 1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG No data
1183080874_1183080880 23 Left 1183080874 22:35455542-35455564 CCTATATACCCAGAAGAATAATT No data
Right 1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183080880 Original CRISPR CAGTCTGAGCCCTGGGATGC TGG Intergenic
No off target data available for this crispr