ID: 1183082911

View in Genome Browser
Species Human (GRCh38)
Location 22:35468239-35468261
Sequence GTGCTTTGATGAGCTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183082909_1183082911 -8 Left 1183082909 22:35468224-35468246 CCTCCTCATCACAGTGTGCTTTG No data
Right 1183082911 22:35468239-35468261 GTGCTTTGATGAGCTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183082911 Original CRISPR GTGCTTTGATGAGCTCTGCT AGG Intergenic
No off target data available for this crispr