ID: 1183084312

View in Genome Browser
Species Human (GRCh38)
Location 22:35477261-35477283
Sequence GGGGGCTCTAAAACGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183084312_1183084318 -1 Left 1183084312 22:35477261-35477283 CCAACCAGCGTTTTAGAGCCCCC No data
Right 1183084318 22:35477283-35477305 CGCTGCAGTCAATCGCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183084312 Original CRISPR GGGGGCTCTAAAACGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr