ID: 1183086976

View in Genome Browser
Species Human (GRCh38)
Location 22:35492339-35492361
Sequence CAGAGAATACACCTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183086976_1183086984 15 Left 1183086976 22:35492339-35492361 CCCTGCTCCAGGTGTATTCTCTG No data
Right 1183086984 22:35492377-35492399 AAAAGCTCACTCTGGCCCCTGGG No data
1183086976_1183086982 7 Left 1183086976 22:35492339-35492361 CCCTGCTCCAGGTGTATTCTCTG No data
Right 1183086982 22:35492369-35492391 CACTGCTCAAAAGCTCACTCTGG No data
1183086976_1183086983 14 Left 1183086976 22:35492339-35492361 CCCTGCTCCAGGTGTATTCTCTG No data
Right 1183086983 22:35492376-35492398 CAAAAGCTCACTCTGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183086976 Original CRISPR CAGAGAATACACCTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr