ID: 1183092940

View in Genome Browser
Species Human (GRCh38)
Location 22:35535860-35535882
Sequence CCCAATTCAGTCAGGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183092940_1183092956 16 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092956 22:35535899-35535921 GGGCTCAGTGGGTGGGGGGAGGG No data
1183092940_1183092958 27 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092958 22:35535910-35535932 GTGGGGGGAGGGGCAGCAAGAGG No data
1183092940_1183092948 4 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092948 22:35535887-35535909 GCTTGGATCATCGGGCTCAGTGG No data
1183092940_1183092949 5 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092949 22:35535888-35535910 CTTGGATCATCGGGCTCAGTGGG No data
1183092940_1183092952 10 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092952 22:35535893-35535915 ATCATCGGGCTCAGTGGGTGGGG No data
1183092940_1183092953 11 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092953 22:35535894-35535916 TCATCGGGCTCAGTGGGTGGGGG No data
1183092940_1183092957 17 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092957 22:35535900-35535922 GGCTCAGTGGGTGGGGGGAGGGG No data
1183092940_1183092954 12 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092954 22:35535895-35535917 CATCGGGCTCAGTGGGTGGGGGG No data
1183092940_1183092946 -5 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092946 22:35535878-35535900 TTGGGGCTTGCTTGGATCATCGG No data
1183092940_1183092955 15 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092955 22:35535898-35535920 CGGGCTCAGTGGGTGGGGGGAGG No data
1183092940_1183092950 8 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092950 22:35535891-35535913 GGATCATCGGGCTCAGTGGGTGG No data
1183092940_1183092951 9 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092951 22:35535892-35535914 GATCATCGGGCTCAGTGGGTGGG No data
1183092940_1183092947 -4 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092947 22:35535879-35535901 TGGGGCTTGCTTGGATCATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183092940 Original CRISPR CCCAATTCAGTCAGGAGCCT GGG (reversed) Intergenic