ID: 1183092948

View in Genome Browser
Species Human (GRCh38)
Location 22:35535887-35535909
Sequence GCTTGGATCATCGGGCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183092940_1183092948 4 Left 1183092940 22:35535860-35535882 CCCAGGCTCCTGACTGAATTGGG No data
Right 1183092948 22:35535887-35535909 GCTTGGATCATCGGGCTCAGTGG No data
1183092944_1183092948 -4 Left 1183092944 22:35535868-35535890 CCTGACTGAATTGGGGCTTGCTT No data
Right 1183092948 22:35535887-35535909 GCTTGGATCATCGGGCTCAGTGG No data
1183092942_1183092948 3 Left 1183092942 22:35535861-35535883 CCAGGCTCCTGACTGAATTGGGG No data
Right 1183092948 22:35535887-35535909 GCTTGGATCATCGGGCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183092948 Original CRISPR GCTTGGATCATCGGGCTCAG TGG Intergenic