ID: 1183093335

View in Genome Browser
Species Human (GRCh38)
Location 22:35538444-35538466
Sequence AAGTGGGTGGGGAGGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183093320_1183093335 30 Left 1183093320 22:35538391-35538413 CCAGGGACGAAGGGGGCAGCTAT No data
Right 1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183093335 Original CRISPR AAGTGGGTGGGGAGGGGGGA AGG Intergenic
No off target data available for this crispr