ID: 1183093944

View in Genome Browser
Species Human (GRCh38)
Location 22:35541181-35541203
Sequence CTCCTGCTGAGCCAGGTGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 377}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183093944_1183093960 9 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093960 22:35541213-35541235 TCGGGGCAGGGCAGGGCCGGCGG 0: 1
1: 0
2: 14
3: 96
4: 905
1183093944_1183093952 -3 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093952 22:35541201-35541223 GAGGCCCCCGGCTCGGGGCAGGG 0: 1
1: 0
2: 1
3: 26
4: 229
1183093944_1183093954 1 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093954 22:35541205-35541227 CCCCCGGCTCGGGGCAGGGCAGG 0: 1
1: 0
2: 2
3: 54
4: 545
1183093944_1183093956 2 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093956 22:35541206-35541228 CCCCGGCTCGGGGCAGGGCAGGG 0: 1
1: 0
2: 2
3: 39
4: 481
1183093944_1183093961 12 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093961 22:35541216-35541238 GGGCAGGGCAGGGCCGGCGGCGG 0: 1
1: 11
2: 32
3: 275
4: 2082
1183093944_1183093948 -10 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093948 22:35541194-35541216 TCAGCAGGAGGCCCCCGGCTCGG 0: 1
1: 0
2: 1
3: 18
4: 166
1183093944_1183093959 6 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093959 22:35541210-35541232 GGCTCGGGGCAGGGCAGGGCCGG 0: 1
1: 5
2: 36
3: 325
4: 2216
1183093944_1183093951 -4 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093951 22:35541200-35541222 GGAGGCCCCCGGCTCGGGGCAGG 0: 1
1: 1
2: 2
3: 46
4: 365
1183093944_1183093949 -9 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093949 22:35541195-35541217 CAGCAGGAGGCCCCCGGCTCGGG 0: 1
1: 0
2: 21
3: 26
4: 325
1183093944_1183093962 20 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093962 22:35541224-35541246 CAGGGCCGGCGGCGGCGAGCCGG 0: 1
1: 0
2: 4
3: 36
4: 492
1183093944_1183093950 -8 Left 1183093944 22:35541181-35541203 CCGGGCACCTGGCTCAGCAGGAG 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1183093950 22:35541196-35541218 AGCAGGAGGCCCCCGGCTCGGGG 0: 1
1: 0
2: 1
3: 18
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183093944 Original CRISPR CTCCTGCTGAGCCAGGTGCC CGG (reversed) Exonic
900186015 1:1333625-1333647 CTGCTGCTGAGCCTGGCGCTGGG + Exonic
900207650 1:1438441-1438463 CTCCTGCAGTGCTGGGTGCCTGG - Intronic
900308565 1:2022730-2022752 CTCCTCCTTAGCCCTGTGCCGGG + Intronic
900363160 1:2299650-2299672 CTCATGTTGTGCCAGGGGCCTGG + Intronic
900565617 1:3330557-3330579 CCCCTGCTGAGGCAGCAGCCAGG - Intronic
900581753 1:3412986-3413008 CTGCTCCTAAGCTAGGTGCCTGG + Intronic
900659641 1:3776180-3776202 CTCCTGCTGAGGCTGGGCCCAGG - Intergenic
900725790 1:4215732-4215754 CTTCTTCTGGGCCAGGTGTCGGG - Intergenic
900977224 1:6025426-6025448 CAGCTGCTGAGCCTGGGGCCAGG - Intronic
901497600 1:9630850-9630872 TCCCTGCTGGGCCAGGAGCCGGG - Intergenic
901527947 1:9835888-9835910 CTCCTGCTAAGCCAGCTGCAGGG - Intergenic
901628018 1:10634603-10634625 CCCCTGCTGGGCCAGGTCCGTGG + Intergenic
902618190 1:17635275-17635297 GTCCTGCTGTGCCAGCTACCTGG + Intronic
902695879 1:18140615-18140637 CTCCTGCTGTGCCCTCTGCCTGG + Intronic
903218123 1:21854336-21854358 CTCCTCCTGGCCCAGGTGCACGG - Exonic
903278774 1:22238338-22238360 CTCCTCCTTTGCCAGATGCCTGG + Intergenic
903342213 1:22661561-22661583 CTTCTGGTGTGCCAGGTGCTGGG - Intergenic
903767383 1:25743539-25743561 CTGCAGCTCAGCCATGTGCCAGG + Intronic
904384371 1:30131868-30131890 CCCCTGCTGAGCCTGGAGGCAGG + Intergenic
904439840 1:30523072-30523094 CTCCTGCTGTTCCTGCTGCCTGG + Intergenic
904577594 1:31514925-31514947 TTCCTGGTGGGCCAGGTCCCTGG + Intergenic
904864017 1:33562263-33562285 CTCCTGCTGATCCTGGTCCAGGG - Intronic
905191704 1:36240405-36240427 CTCATGCTGTGACAGATGCCTGG - Intronic
905541848 1:38766179-38766201 CTCCTGCTGTTCCAGCAGCCTGG - Intergenic
905896243 1:41547625-41547647 CTCCTGCTGGGCCAGGCGTTAGG + Intronic
906135251 1:43495263-43495285 CTCCTGCTGTTCCCAGTGCCTGG - Intergenic
906144898 1:43554165-43554187 CTCCTGCTGAGCCGGGTCGTTGG + Intronic
906994816 1:50780887-50780909 TTCCTGCTGAGCCATGTGTTTGG - Intronic
908080625 1:60574272-60574294 CTCCTGCTCACCCAGGTGGAGGG + Intergenic
908351178 1:63287072-63287094 CTCCTGCAGACCCAGGATCCAGG + Intergenic
909131800 1:71746243-71746265 CTCCTGTAGAGCCATGTGTCAGG + Intronic
911664726 1:100539660-100539682 CACCTGCTGCACCAGTTGCCCGG + Exonic
911883248 1:103268001-103268023 CTTCTGCTGAGGCAGTTGCCAGG + Intergenic
912372711 1:109186212-109186234 CTCCTGCTGTGTCTGCTGCCTGG - Intronic
912545883 1:110451143-110451165 CTCCCGCTCAGCCTTGTGCCTGG - Intergenic
914846481 1:151286582-151286604 CTCCTGCTGAGCCTCCAGCCAGG - Exonic
915327555 1:155088496-155088518 CACTTGCTGAGCCAAGTGCCTGG + Intergenic
916278520 1:163023286-163023308 CACCTACTGACCCAGGTACCAGG - Intergenic
916552608 1:165863112-165863134 CTTCTCCCGTGCCAGGTGCCAGG + Intronic
916917686 1:169427382-169427404 CTGCCGCGGAGGCAGGTGCCGGG - Intronic
917363069 1:174198723-174198745 CTCTTGATGACCAAGGTGCCCGG - Intronic
917455634 1:175183466-175183488 CCCCTGCAGAGCCAGGTGATGGG + Intronic
917643908 1:177010607-177010629 CTTCAGCTCAGCCAGGTGACAGG - Intronic
919643948 1:200073792-200073814 CTGCTGCTTAGCAATGTGCCTGG - Intronic
919653062 1:200169384-200169406 CCTCTGCTGAGCCAGGGGGCTGG - Intronic
920948137 1:210548574-210548596 CTCCTGCTGTGCCAGGGCTCTGG + Intronic
921599463 1:217090725-217090747 CCCCTGGTGGGCCAGATGCCCGG - Intronic
923044419 1:230345031-230345053 ATGCTGCAGAGGCAGGTGCCTGG + Intronic
1062834101 10:624736-624758 GACCTGCTGAGCCACGAGCCAGG + Intronic
1064250765 10:13704775-13704797 CTTCTTCTCAGCCAGGTTCCAGG + Intronic
1067111969 10:43407550-43407572 CTCCTGCTGCGCCGGCTGCCCGG - Intronic
1069663496 10:70139377-70139399 CTCCTGCTGTGCCAGGCCCATGG - Exonic
1069734571 10:70645308-70645330 CTCCTGGTGTGCCAGTTGCTAGG + Intergenic
1073501101 10:103937857-103937879 CTCCTGGTGAGCCTGGTGTCAGG + Intergenic
1074115850 10:110457172-110457194 CAGTTGCTTAGCCAGGTGCCAGG + Intergenic
1074431796 10:113400841-113400863 TGCCTCCTGAGCCAGGTGCTGGG - Intergenic
1074782066 10:116809157-116809179 CTGCCCCTGAGCCAGGTGCCGGG - Intergenic
1075718942 10:124573970-124573992 CTCCAGGGGAGCCAGGTCCCTGG - Intronic
1076157502 10:128215078-128215100 CTCTTGCAGAACCAGGTGCAAGG - Intergenic
1076435580 10:130438972-130438994 CGCATGCTCAGCCAGGTGTCTGG - Intergenic
1076629073 10:131841890-131841912 CTCCTGGGGTGCCAGGTGCCTGG + Intergenic
1076751813 10:132547088-132547110 CGCCTTCAGTGCCAGGTGCCAGG + Intronic
1076781837 10:132728850-132728872 CAGCTGCTGAGCCCGGTGGCCGG + Intronic
1076807711 10:132867282-132867304 CTGCAGCTGAGCCAGGCGGCCGG - Intronic
1076910722 10:133387669-133387691 CTCCTGCTGCGCGTGGTGCACGG - Intronic
1077475657 11:2789086-2789108 TGCCTGCTGAGCCTGGTTCCAGG - Intronic
1078341059 11:10498290-10498312 CTCCTGCAAAGCCAGGCACCTGG - Intronic
1078600345 11:12724853-12724875 CACCTGCCAGGCCAGGTGCCTGG + Intronic
1078931796 11:15918313-15918335 GTCTAGCAGAGCCAGGTGCCAGG + Intergenic
1079193386 11:18301694-18301716 CTCCTGCTCAACGATGTGCCAGG + Intronic
1083066824 11:59932217-59932239 CTCCTGCTGTTCATGGTGCCTGG + Intergenic
1083204089 11:61137587-61137609 CTCCTGCCCAGCCTGGTGCTGGG - Intronic
1083334588 11:61915255-61915277 CTCTGGATGAGCCAGCTGCCAGG - Intronic
1083713746 11:64564158-64564180 CTGCTGCCCAGCCAGGAGCCTGG - Intronic
1083733734 11:64667893-64667915 CTCCTGCTGGGCCAGAAGACAGG - Intronic
1083745387 11:64733340-64733362 CTCCTGCCGAACCAGGTGCTAGG + Intronic
1083939098 11:65885501-65885523 CCCCCACTGACCCAGGTGCCTGG - Exonic
1084153599 11:67302403-67302425 CTGCTGCTGAGCTTGGGGCCTGG + Exonic
1084176188 11:67423607-67423629 CTTCTGCTTAGCCAGGCGCATGG - Exonic
1084266641 11:68008546-68008568 CACATGCTGAGCCACGTGACTGG + Intergenic
1084564372 11:69920898-69920920 CTCCTGCTGCCCCAGGAGCGGGG + Intergenic
1084835513 11:71799293-71799315 GTCCTGCTGTGCCAAGTGCTGGG + Intronic
1084910379 11:72382601-72382623 CACCTGCTGACCCAGGTACCAGG + Intronic
1085465368 11:76719793-76719815 ACCCTGCTGAGCCGTGTGCCTGG - Intergenic
1087381591 11:97409981-97410003 ACCCTGATGACCCAGGTGCCAGG + Intergenic
1088283435 11:108161260-108161282 CTGCCCCTGAGCCAGGTGTCCGG + Exonic
1088801809 11:113313788-113313810 CTTGTGCTGAGTCAGTTGCCAGG - Intergenic
1088858637 11:113779638-113779660 CAGCAGCTGAGGCAGGTGCCAGG - Intergenic
1089375127 11:117988656-117988678 CCCTTGCTGAGCAATGTGCCGGG + Intronic
1091044288 11:132312109-132312131 CTGCAGCTGAGCTGGGTGCCAGG - Intronic
1091952214 12:4603587-4603609 CTGCTGCGGAGGCAGGTGCCAGG - Intronic
1092131543 12:6116719-6116741 CTCCTGGTGAGGCAGGCTCCAGG - Intronic
1092407772 12:8232853-8232875 GTCCTGCTGTGCCAAGTGCTGGG - Intergenic
1092587278 12:9912280-9912302 GTCCTGCAGAGCCAGCTGGCTGG - Intronic
1093071705 12:14712242-14712264 CACCTACTCAGCTAGGTGCCAGG - Intergenic
1093121752 12:15279290-15279312 CCTCAGCTGGGCCAGGTGCCTGG - Intronic
1095962576 12:47844688-47844710 CTCCTCCAGGGCCACGTGCCAGG - Exonic
1096085904 12:48865028-48865050 CTGCTGCAGAGCAAAGTGCCTGG - Intronic
1096969943 12:55657619-55657641 CTGCTGCTGAGGCAGGAGCATGG - Intergenic
1097053469 12:56237197-56237219 CTGCTGCTGAGCCTCGTGTCTGG + Exonic
1097153645 12:56997024-56997046 ATCCTGCTGACCCAGCTGCAGGG - Intergenic
1099070192 12:78036528-78036550 CTCCTGCTGAGACATGTGATTGG + Intronic
1099424355 12:82504099-82504121 GTCCTGCTTATCCAGATGCCTGG + Intergenic
1102007986 12:109600824-109600846 CTCCAGTTGGGCCAGGTGTCCGG + Intergenic
1102112023 12:110371877-110371899 CTCCTGCCGAGCCACCTGCCTGG - Intergenic
1102236944 12:111299359-111299381 CTCCTGCTGAGCCTTCTACCTGG - Intronic
1102614331 12:114139953-114139975 CTAGTGCTGAGCCAGGGCCCTGG - Intergenic
1103698110 12:122833433-122833455 CAGATGCTGAGCCTGGTGCCCGG + Intergenic
1103723935 12:122988716-122988738 TTTCTGCTGAGACAGGTACCCGG - Exonic
1103822989 12:123712942-123712964 CTCCCGCTGAGCTCGGTGCCCGG - Intronic
1103912487 12:124360079-124360101 GTCCTGCTGAGCCAGGTCGCAGG - Intronic
1104061276 12:125270598-125270620 CTCCTGCTGAGACTGCTTCCAGG + Intronic
1104369156 12:128207735-128207757 CTCCTGCTGAGGCAGGAGAATGG - Intergenic
1104576807 12:129973419-129973441 CTCCTGCAGAGGCTGGTGACAGG + Intergenic
1104854961 12:131897162-131897184 CTCCAGCAGAGCCCGGTGCCCGG - Intronic
1104860637 12:131921609-131921631 CGCCTGCTGAGCCAGGCAGCTGG - Exonic
1105775267 13:23653921-23653943 CTCCTGCAGAACCAGCTGCCAGG - Intronic
1106421481 13:29589533-29589555 CTCCAGCTGTGCCAGGTGCCTGG + Intronic
1107331616 13:39307280-39307302 CTCTTCTTCAGCCAGGTGCCTGG + Intergenic
1109319340 13:60790738-60790760 CTCCTGCTGACCCAGGCTGCTGG + Intergenic
1110619956 13:77584380-77584402 CCCCTGCTGGGCCAGGAGCCAGG - Intronic
1111745242 13:92259914-92259936 CTCCTCCTGAGACAGCTGGCAGG - Intronic
1112558531 13:100491704-100491726 CTCCTGCTGAGCCAGCCACCAGG - Intronic
1113640123 13:111951411-111951433 CTCCTGCTGAGCCAGCAGCTAGG + Intergenic
1114066585 14:19064355-19064377 CTCCTCCTCAGCCTGGTGACTGG - Intergenic
1114095681 14:19335668-19335690 CTCCTCCTCAGCCTGGTGACTGG + Intergenic
1114529315 14:23385970-23385992 CTCCTGCTCCGCCAGCTTCCGGG + Exonic
1114534726 14:23415671-23415693 CTCCTGCTCCGCCAGCTTCCGGG + Exonic
1114535409 14:23419264-23419286 CTCCTTCTCATCCAGCTGCCGGG + Exonic
1115152209 14:30298606-30298628 CTCCTTCTGACTCAGGTGGCTGG + Intergenic
1115333920 14:32226569-32226591 CTCCTGTTAAGGCAGGTCCCAGG - Intergenic
1115382410 14:32756061-32756083 CACCTGCTGACCCAGGTAGCAGG - Intronic
1117185852 14:53240148-53240170 CTACTGCTCAACCAGTTGCCTGG - Intergenic
1117520801 14:56549673-56549695 CTCCTGCTGAGCCATGAACTGGG - Intronic
1118315087 14:64721315-64721337 CTCCCTCTGAGCTAGGTGCCTGG + Intronic
1118454829 14:65935102-65935124 CACCTGCTAAGCCAGGTGGTGGG - Intergenic
1118761299 14:68881810-68881832 CTCCTCCTGAGCAATGAGCCTGG - Intronic
1118930913 14:70239560-70239582 TTCCTGCTGATGCAAGTGCCTGG - Intergenic
1118953975 14:70462722-70462744 TTCCTGCTGATGCAAGTGCCTGG + Intergenic
1119158016 14:72429414-72429436 CTCCTGCTGAGACTGTTGTCTGG + Intronic
1121016930 14:90554536-90554558 CTGGTGCTGTGCCAGGTGCGGGG + Intronic
1121428763 14:93872482-93872504 CAGATGCTGAGCCAGGTGCTGGG - Intergenic
1122134959 14:99627500-99627522 CACATTCTGTGCCAGGTGCCAGG + Intergenic
1122388983 14:101367648-101367670 CTCCTGCTGGGGCTGGAGCCAGG - Intergenic
1122480193 14:102042217-102042239 CTTCTGCAGAGCCTGGTGCAGGG - Exonic
1122806794 14:104263880-104263902 CCCCAGCTGAGCCAGGGGCAGGG - Intergenic
1122818676 14:104328756-104328778 CTCCAGCTGGGCCTGGTGCCTGG + Intergenic
1122937689 14:104967536-104967558 CTCCTGCTGGCCCTCGTGCCTGG + Intronic
1122938473 14:104970641-104970663 CCCCTGATGGGCCAGGAGCCTGG + Intronic
1124149883 15:27167919-27167941 CTTCTGCAGTCCCAGGTGCCAGG - Intronic
1124187383 15:27542291-27542313 CTCCAGCCAAGCCAGGTGGCAGG + Intergenic
1125726159 15:41869299-41869321 CTCCTGGTCTGCCAGGTCCCAGG + Intronic
1127183461 15:56451272-56451294 CTCCTCCTGAACCAGGGACCAGG + Intronic
1128761339 15:70218007-70218029 TGCATGCTGAGGCAGGTGCCTGG + Intergenic
1128785713 15:70395406-70395428 TGCCTGCTCAGCCTGGTGCCCGG - Intergenic
1130846833 15:87755427-87755449 CTGCTGCTGCTGCAGGTGCCTGG - Intergenic
1130959949 15:88652700-88652722 GTCCTGCTGTGCCTGGTCCCTGG + Intronic
1132052462 15:98618346-98618368 GTCCTGCTGAGCCCTGTGCACGG + Intergenic
1132107531 15:99074151-99074173 CTCATACTGTGCCAGGTGCTGGG - Intergenic
1132571863 16:647744-647766 GTCGGGCTGAGCCAGGTCCCAGG - Intronic
1132575887 16:663842-663864 CCCCTGCTGGACCAGGTTCCTGG + Intronic
1132936281 16:2482946-2482968 TTCCTTCTGAGCCAAGTGGCTGG - Intronic
1133241213 16:4415808-4415830 GAATTGCTGAGCCAGGTGCCGGG - Intronic
1133340334 16:5031866-5031888 CTCCTCCTCAGACAGGTACCTGG + Exonic
1134178173 16:12025498-12025520 CAGGTGCTGAGCTAGGTGCCAGG + Intronic
1136551909 16:30986408-30986430 CTCCTCCTCTGCCAGGTACCCGG + Exonic
1136607626 16:31347138-31347160 CTCCAGATTAGCAAGGTGCCTGG - Intergenic
1137271822 16:46907272-46907294 TTCCTCCTGTGCCAGGTGCTGGG + Intronic
1137564718 16:49525737-49525759 CTCCTGCTGATCAAGCAGCCAGG + Intronic
1137625392 16:49904499-49904521 TGGCAGCTGAGCCAGGTGCCAGG - Intergenic
1137774187 16:51041800-51041822 CTCCTGCAGAGCCAAGTGCAGGG + Intergenic
1138595277 16:58026254-58026276 CGCCTGCCGGGCCAGGAGCCAGG + Exonic
1138623454 16:58230549-58230571 GTCCAGCTGACCCAGGGGCCTGG + Intergenic
1138660005 16:58511283-58511305 CTCCTCCTGAGTCAGGAGGCTGG - Intronic
1140236419 16:73163217-73163239 CACATACTGAGCCAGGTGCAGGG + Intergenic
1140638738 16:76947062-76947084 CTTCTGCTGAGTCATATGCCAGG + Intergenic
1141362150 16:83405842-83405864 CTCCTGCTGAGAGAAGAGCCGGG - Intronic
1142186916 16:88699019-88699041 CTCCTGCTGGTCCAGGTTGCGGG + Exonic
1142610591 17:1107634-1107656 CTGCTCCTGAGCCAGGAGTCAGG - Intronic
1142623843 17:1180222-1180244 ATCCTGCTGAGCCCGGCGCGGGG - Intronic
1142863638 17:2777787-2777809 GTTGTCCTGAGCCAGGTGCCAGG + Intronic
1143232241 17:5366723-5366745 CTACTGATGGGCCAGGTGCATGG - Intronic
1143253008 17:5536795-5536817 CTCCTGCTCAGCCCTGGGCCTGG + Intronic
1144807524 17:17977690-17977712 CTCCTGCTTGGCCAGCTGCCCGG - Exonic
1146905139 17:36613293-36613315 CTCCTGCAGGGCCAGGTGCCAGG + Intergenic
1147660125 17:42112922-42112944 CTGCTCCTGATCCAGATGCCAGG - Intergenic
1147969497 17:44212004-44212026 CTCCTGCAGAGCCAGGTGGGGGG + Exonic
1148211833 17:45813320-45813342 CTCCTGCTGGGTCAGGGGCTTGG - Intronic
1148771746 17:50071403-50071425 TTCTTGCTGAGCCAGGAGGCAGG + Exonic
1148777669 17:50104792-50104814 CACTTGCCGAGGCAGGTGCCTGG + Intronic
1148860205 17:50600656-50600678 CTGCTGAGGAGCCAGGAGCCGGG + Intronic
1149449305 17:56737596-56737618 CTGCTGCTGCGCCAGCTGCCAGG - Intergenic
1151956654 17:77383498-77383520 ATCGTGCTCAGCCAGGGGCCAGG - Intronic
1152144720 17:78561377-78561399 CTCCTGGACAGCCAGGGGCCGGG - Intronic
1152331878 17:79678255-79678277 CTCTTGCTAAGCCATGTTCCTGG - Intergenic
1152495592 17:80669112-80669134 CTCCTGCTGAGCCAGCAGAACGG - Intronic
1152778277 17:82215421-82215443 CTTCAGCTGAGCCACATGCCCGG + Intergenic
1152911983 17:83010204-83010226 CTGCTGCTGAGCCACGCCCCAGG + Intronic
1156462401 18:37328478-37328500 CTTCTGCTGAGCAGGGAGCCAGG - Intronic
1157297497 18:46456843-46456865 CTCCTGCTCAGCCAGGCGGATGG - Exonic
1158155122 18:54417228-54417250 CTCAGGCTGAGCTAGGTCCCAGG - Intergenic
1159004330 18:62999236-62999258 CTTCTGATGAGCTAAGTGCCAGG + Intergenic
1159584616 18:70271836-70271858 TTCCTGCAGAGCCAGGTGAATGG - Intergenic
1160010565 18:75104554-75104576 CGCCTGCTCAACCCGGTGCCTGG + Intergenic
1160574299 18:79842034-79842056 CCCCTGCAGACCCAGGTGCCAGG + Intergenic
1160696201 19:485782-485804 CTCCTGCTGTGCCGTGTGCCAGG - Intergenic
1160698153 19:494473-494495 CTCCTGCCCAGGCTGGTGCCGGG - Intronic
1161975332 19:7605326-7605348 CTACTGCAGAGCCTGGCGCCAGG + Exonic
1162389105 19:10378410-10378432 TTCCAGCTGAGCCACCTGCCGGG - Exonic
1163356592 19:16816123-16816145 CTGCTGCTCACCCAGGTGCATGG - Exonic
1163444094 19:17336800-17336822 CACCTGCAGAGCCAAGTGTCCGG - Intronic
1164147053 19:22518541-22518563 CTCCTGCGGACCCCGGTGCCAGG - Intronic
1164504094 19:28843863-28843885 CTCCTGTAGAGCCAGAGGCCCGG - Intergenic
1164965443 19:32479295-32479317 CCCCTGATGAACCTGGTGCCTGG - Intronic
1165099117 19:33428091-33428113 CTCCTGCATAGCCAGGAGCCAGG + Intronic
1165123851 19:33580541-33580563 CCCCTGGCGAGCCAGGTGCCAGG - Intergenic
1166100036 19:40566231-40566253 CTCCTGCAGAGCCGGGAGCTGGG + Exonic
1166843596 19:45713046-45713068 CTCCTCCTGACCCAGGGGGCCGG - Exonic
1167116295 19:47491115-47491137 CCCCAGCTGAGCCAGGTGGGAGG - Intronic
1167573868 19:50308416-50308438 CTGCTGATGTGCCAAGTGCCAGG + Intronic
1167580791 19:50341039-50341061 CTCCTGCTCAGCCAGTGGCTCGG + Intronic
1167645007 19:50700839-50700861 CTCCTTCAGGGCCAGCTGCCTGG - Intronic
924960578 2:30800-30822 CTTCTGCTGGGTCTGGTGCCAGG + Intergenic
925090113 2:1148484-1148506 CTCCTGCTCAGCCTGGTGCTGGG - Intronic
925404178 2:3595266-3595288 CTCCTGCTGAGCGAGGAGGATGG + Intronic
925404603 2:3597809-3597831 CTGCTGCTGAGGCAGGAGCCGGG + Intronic
926088195 2:10033201-10033223 CTCCTCCTGAGCCAAGAGGCTGG + Intergenic
926707237 2:15845511-15845533 CTCCTGATGAGCCTGCTCCCTGG - Intergenic
927025388 2:19063643-19063665 CTCTTGCTCAGGCAGGTGGCTGG - Intergenic
927077042 2:19589048-19589070 TTCCTACTGTGCCAGGTGCCAGG + Intergenic
928119972 2:28576957-28576979 TTCCTGCTAAGCCCTGTGCCAGG + Intronic
929243981 2:39682506-39682528 CTTCTGCTGGCCCAGGAGCCAGG + Intronic
929560096 2:42951129-42951151 CTCCTGCTGAGACACTTGCTGGG - Intergenic
931233663 2:60395336-60395358 CTCCTGTGGAGCCAGGCACCAGG + Intergenic
932330570 2:70896328-70896350 CTCTAGCTGAGCCTGGGGCCTGG - Intergenic
932422324 2:71608486-71608508 CTCATGCTGAGGAAGCTGCCTGG + Intronic
932579882 2:72986220-72986242 CTGAGGCTGAGCCAGGTGGCTGG + Intronic
933194376 2:79371847-79371869 CTCCTGGTGATCCTGGTGCTAGG + Intronic
935742388 2:106161113-106161135 CACATGCTGAGCCAGCTGCCTGG + Intronic
936947028 2:117940364-117940386 CTCCTCCTGTTCCTGGTGCCTGG - Intronic
937223305 2:120354122-120354144 CTCCAGGTGAGTCAGGAGCCCGG - Intergenic
937320243 2:120956641-120956663 CTCCTGCAGAGCCAGCCTCCCGG + Intronic
937362785 2:121240622-121240644 GTCCTGGTGAGCCACATGCCAGG - Intronic
937671339 2:124540727-124540749 TTTCTGCTGTGCCAGGTGCTGGG + Intronic
938483975 2:131684483-131684505 CTCCTCCTCAGCCTGGTGACTGG - Intergenic
940861320 2:158773332-158773354 CTGCCCCTGAGCCAGCTGCCTGG + Intergenic
941221497 2:162787312-162787334 CTCCTGCAGACCCAGGTTCTAGG + Intronic
944373350 2:199011708-199011730 CTCCTGCAGACCCAGGGGCCAGG - Intergenic
944615284 2:201452516-201452538 CGCCTGCTTAGCACGGTGCCTGG + Intronic
946001091 2:216483092-216483114 CTCCTGCTGAGCCTGGACACAGG - Intergenic
946245833 2:218386950-218386972 TCCCTGCTGCGCCGGGTGCCAGG + Intronic
947628290 2:231634968-231634990 CTGATACTGAGCCAGGTGTCTGG - Intergenic
947992917 2:234500895-234500917 TTCCTGCTCTGCCAGGTTCCTGG - Intergenic
948674277 2:239587911-239587933 CTCCTGCTGGGCCGTGAGCCAGG + Intergenic
1168813946 20:723920-723942 CAGTTGCTGAGCCAGGTGGCTGG + Intergenic
1171002947 20:21433306-21433328 CTGGTGCTGAGCCATGTGCATGG - Intergenic
1171096054 20:22333136-22333158 CTCGCACTGTGCCAGGTGCCGGG - Intergenic
1172266834 20:33623179-33623201 TTCGTGCTGAGCCAGGTACTGGG - Exonic
1172442985 20:34978827-34978849 CCCCTGCTCTGCCAAGTGCCTGG - Intronic
1172843886 20:37918205-37918227 CTCCTGCTGGGCCACATACCTGG - Intronic
1172996279 20:39072440-39072462 CTCCTGCTGGTCCTGGTTCCAGG + Intergenic
1173708577 20:45135280-45135302 CACCTGCTGACCCAGGCACCAGG - Intergenic
1173973886 20:47172931-47172953 TCCCTGCTGTGCCAGGCGCCAGG + Intronic
1174201058 20:48806773-48806795 CTGATGCTGAGCCCAGTGCCTGG - Intronic
1174780639 20:53385743-53385765 CTCCTTCTGAGCCAGGGACCAGG + Intronic
1175158993 20:56994154-56994176 CTCCTGTGGAGCCAGAAGCCTGG + Intergenic
1175723787 20:61303321-61303343 CTGCTGCTGGTCCAGGTGCCTGG + Intronic
1179414470 21:41187068-41187090 CTCCTGGTGAGGCAGGAGGCGGG - Intronic
1180033396 21:45228026-45228048 CTACTGGTGGGCCAGGTTCCTGG - Intergenic
1180140988 21:45893273-45893295 CCCCTGCTGTGACAGGTGCCAGG - Intronic
1180485066 22:15786945-15786967 CTCCTCCTCAGCCTGGTGACTGG - Intergenic
1180594375 22:16963717-16963739 TTCCAGCCGAGCAAGGTGCCTGG - Exonic
1180850935 22:19019791-19019813 CACCTCCTGAGCCAGCTGCTGGG - Intergenic
1180867813 22:19129532-19129554 CCCCTCCTCACCCAGGTGCCTGG + Intergenic
1181073909 22:20361831-20361853 GTCCTCCTTAGCCATGTGCCGGG - Intronic
1181178930 22:21053976-21053998 CTCCGGCAGAGCCTGGTGCATGG + Intronic
1182476746 22:30580699-30580721 CTCCTGTTGAGAAAGGGGCCAGG + Exonic
1182524995 22:30909657-30909679 TTCATGCTGAGCCATGTCCCTGG - Intergenic
1183093944 22:35541181-35541203 CTCCTGCTGAGCCAGGTGCCCGG - Exonic
1183120470 22:35726539-35726561 CTCCTGCTGTCACAGGTGCTAGG - Exonic
1183184843 22:36285909-36285931 CTCCTGCTGGGCCTGGCGCTTGG + Exonic
1183524467 22:38315352-38315374 CTCCTTGGGAGCCAGGTGCCGGG - Intronic
1184778942 22:46636597-46636619 CTCCTCCAGAGCCAGGTAACAGG - Intronic
1184831853 22:46993873-46993895 CACCTCCCGAGCCAGGAGCCAGG + Intronic
1184960072 22:47922201-47922223 CACCTCCTCAGCCAGGTGCTGGG - Intergenic
1185132758 22:49049137-49049159 CTCATGCTGTTCCAGGTGCTGGG + Intergenic
950686480 3:14622002-14622024 CTCCAGCTGAGCCCGGAGCCTGG - Intergenic
950708254 3:14797089-14797111 CTCTACCTGAGCCAGGGGCCAGG + Intergenic
950835786 3:15917865-15917887 CTCCTACTTAACCAGCTGCCGGG - Intergenic
952955631 3:38555639-38555661 CCCCTGGTGAGCCAGGCTCCTGG - Exonic
953793112 3:45963493-45963515 CTCCTACTGAGCCAGAGCCCAGG + Intronic
953886469 3:46717198-46717220 CTCCTGCTGAGGTAGGGGGCAGG - Intronic
954292091 3:49655108-49655130 CACATGCTCTGCCAGGTGCCAGG + Exonic
954375258 3:50191231-50191253 GTGGTGCTGAGCCTGGTGCCGGG + Intergenic
954390999 3:50267855-50267877 CAGCTGCTGAGGCAGGTTCCAGG - Intronic
954401792 3:50322957-50322979 CGCCAGCTGCGCCAGGTGACAGG + Intronic
954533723 3:51342486-51342508 CTCCAGGTTAGCCAGGTGCCAGG - Intronic
954725775 3:52608218-52608240 CTACTCCTGAGCCAGTTACCAGG - Intronic
957052842 3:75423307-75423329 GTCCTGCTGTGCCAAGTGCTGGG - Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960992725 3:123322362-123322384 CACCTGCTGAGGCTGGTGCATGG + Intronic
961302006 3:125928221-125928243 GTCCTGCTGTGCCAAGTGCTGGG + Intergenic
961514182 3:127422719-127422741 CTGCAGCAGAGCCAGGAGCCTGG + Intergenic
961633355 3:128317693-128317715 CTGCAGCTGAGGCAGGAGCCAGG - Intronic
961886464 3:130099604-130099626 GTCCTGCTGTGCCACGTGCTGGG - Intronic
966246816 3:177817907-177817929 CTCCTGCAGAGTCAGGCACCAGG - Intergenic
966931333 3:184677676-184677698 CTCCAGCTGAGCCAGCTCCAGGG + Intronic
967300035 3:188003863-188003885 CTCCTGGTGAGACAGGCTCCAGG + Intergenic
968941814 4:3642996-3643018 CTCCTGCTGGGACATGTGCAGGG + Intergenic
969272613 4:6113074-6113096 CTCCAGATGAGGCAGGTGCCTGG - Intronic
969563609 4:7964863-7964885 CTACTGCTGTTCCAGCTGCCCGG + Intergenic
969692386 4:8710716-8710738 CTCCTGCTCAGCTCGGTGGCGGG + Intergenic
973823694 4:54684757-54684779 CTTCTGCTGTACCAGTTGCCAGG + Intronic
974740600 4:66001779-66001801 CTACTGCTGAGCCTGGAACCTGG + Intergenic
976422352 4:84860454-84860476 TTCCTTCTGAGTCATGTGCCGGG + Exonic
976707326 4:88033085-88033107 CTTCTCCTGTGCCAGGTCCCAGG - Intronic
982904441 4:161049902-161049924 CTTGTGCTGAGTCAGTTGCCCGG - Intergenic
983926832 4:173411886-173411908 CTCCTGCTGAGGCACATGCCTGG - Intergenic
984993389 4:185403864-185403886 CTCCTGCTGAGGCAGGAGAATGG + Intronic
985014852 4:185623430-185623452 CTCCTGCAAAGGCAGGTGCCCGG - Exonic
985546039 5:509676-509698 CACCTGCTGTGCCAGGTCCCTGG - Intronic
985718298 5:1475367-1475389 CTCCAGGTGAGCCAGGGACCAGG + Intronic
985760227 5:1745161-1745183 CCCCTGCTGGCCCAGGTGGCTGG + Intergenic
985986496 5:3520846-3520868 CTCCTGCTGCAGCAGCTGCCTGG - Intergenic
986051545 5:4094777-4094799 CACCTGCTGTGCCAGGTGCAGGG - Intergenic
986343572 5:6813542-6813564 CTCATGCTTGGCCAGGAGCCAGG - Intergenic
987299595 5:16585599-16585621 CTCCAGCTGAGCTAGGTACTAGG + Intronic
989625772 5:43428354-43428376 CTCCTGCAGGGCCTGCTGCCTGG + Intergenic
990254752 5:53955718-53955740 CTGCTGCTGAGCCAGGAAACAGG - Intronic
990383488 5:55237004-55237026 TGCCTGCTGTGCCAGGTGCTGGG + Intergenic
994320795 5:98392431-98392453 CTCCTGCTGGGCCGGCTGCGGGG + Intergenic
997876820 5:137557061-137557083 CTCCTGCAGTCCCAGCTGCCTGG - Intronic
997903849 5:137794934-137794956 CCCCTGCTTAGCCAGGGGACAGG + Intergenic
999671751 5:153964662-153964684 CTCCTGTGGAACCAAGTGCCAGG - Intergenic
999740304 5:154544957-154544979 CTTATGCTGTGCCAGGTCCCGGG - Intergenic
1001117720 5:168953658-168953680 CTGCTGCAGAGCCCAGTGCCTGG + Intronic
1001753303 5:174147716-174147738 GTCCTGCTGAGCATGGTGCAGGG - Intronic
1002444245 5:179279500-179279522 CCCCTGCTGTGACAGCTGCCTGG + Intronic
1002548492 5:179969246-179969268 GTCCAGCTGTGGCAGGTGCCAGG - Intronic
1003116109 6:3284806-3284828 CCTGTGCTGAGCCTGGTGCCAGG + Intronic
1003537566 6:6988844-6988866 CTCCTGCCGAGCATGGTGGCAGG - Intergenic
1003984424 6:11420389-11420411 TACCTGCTGATCCAGGTACCAGG + Intergenic
1006899361 6:37490163-37490185 CTCAGGCTGGGCCAGATGCCAGG - Intronic
1007179177 6:39915981-39916003 CCATTGCTGAGCCAGGGGCCTGG - Intronic
1007416148 6:41692452-41692474 CTCTGGCAGTGCCAGGTGCCTGG - Intronic
1007973192 6:46073802-46073824 CTTCTGCTGAGCCCACTGCCTGG + Intronic
1008009225 6:46445328-46445350 CACCTGCTGACCCAGGCACCAGG + Intronic
1008622451 6:53284178-53284200 CTCCTGCAGTCCCAGCTGCCTGG + Intronic
1010361684 6:75002548-75002570 CCACTGTTGAGCCAGGAGCCAGG - Intergenic
1011635609 6:89369995-89370017 CTCCTGGTGTGCCTGGTGCCTGG - Intronic
1011810994 6:91132216-91132238 CTTGTGCTGAGCCAGGTGATAGG + Intergenic
1013594321 6:111647033-111647055 CTCCTCCTGGGCCTTGTGCCTGG - Intergenic
1014381510 6:120748691-120748713 GACCCTCTGAGCCAGGTGCCGGG - Intergenic
1016856040 6:148671510-148671532 GACCTGCTGAGCCAGGCCCCGGG + Intergenic
1017718698 6:157229865-157229887 CACCTGCTGCCCCAGCTGCCTGG - Intergenic
1017846330 6:158261749-158261771 CTCCTGCTGATCAGGGTTCCAGG + Intronic
1017967743 6:159281132-159281154 CTCCTCCGGATCCAGGTCCCAGG - Intergenic
1018641405 6:165907590-165907612 CTGCTCCTCAGCCAGGTGTCAGG + Intronic
1019195744 6:170281702-170281724 GTCCTGCTGAGCCAGCAGGCGGG + Intergenic
1019495827 7:1340206-1340228 CACCTGCTGTCCCAGCTGCCTGG + Intergenic
1019892887 7:3960624-3960646 CTCCTACTGAACCAAGTCCCGGG - Intronic
1020518165 7:9151942-9151964 CTTCTGCTGAGCCAGTTCCTGGG - Intergenic
1022807934 7:33841921-33841943 CAGCTGTTGGGCCAGGTGCCAGG + Intergenic
1023702513 7:42906423-42906445 CTCCTGCAGTCCCAGGTACCAGG - Intergenic
1024151006 7:46571264-46571286 TCCCTGCTGTGCCAGTTGCCAGG - Intergenic
1024372933 7:48607154-48607176 GACCCGCTGAGCCAGGTGCCAGG + Intronic
1024770144 7:52712982-52713004 TGGCTGCTGTGCCAGGTGCCAGG + Intergenic
1026458909 7:70596264-70596286 CTCCCGCGGAGCCGGCTGCCAGG + Intronic
1026471937 7:70701160-70701182 ATGCTGCTGAGCCTGGTGGCAGG + Intronic
1026866170 7:73825280-73825302 CTCCTGTTCAGCCTGGTGCCAGG + Intronic
1027946361 7:84749765-84749787 CACCTGCTGACCCATGTACCAGG + Intergenic
1029264537 7:99327801-99327823 CTGCTGGTGAGGCTGGTGCCTGG + Intronic
1032467652 7:132156507-132156529 CTCCTGCCGTGCCAGGGGCTGGG + Intronic
1032498985 7:132385553-132385575 AGCTTGCTGAGTCAGGTGCCTGG - Intronic
1032781986 7:135170831-135170853 CTCCGACTGAGGCAGCTGCCGGG - Intergenic
1034008772 7:147505121-147505143 CTGTTTCTGAGCCAGGGGCCCGG - Intronic
1034093336 7:148383862-148383884 ATCCAGGTGATCCAGGTGCCAGG - Exonic
1034342015 7:150363551-150363573 CTGCCACTGTGCCAGGTGCCCGG - Intergenic
1034688759 7:152997249-152997271 CTGCTGCTGTGCCAAGTTCCTGG - Intergenic
1035254714 7:157618961-157618983 CCCATTCTGAGCCAGGTGACGGG - Intronic
1036075495 8:5494567-5494589 TTCCTGCTGAGGGAGGGGCCAGG + Intergenic
1036646243 8:10612669-10612691 CTCCTGCTGCCCCAGGACCCCGG - Exonic
1036848181 8:12183952-12183974 GTCCTGCTGTGCCAAGTGCTGGG - Intronic
1036869543 8:12426235-12426257 GTCCTGCTGTGCCAAGTGCTGGG - Intronic
1038486061 8:27935971-27935993 TTCCTGCTGAGCTAGGAACCAGG - Intronic
1039954308 8:42195422-42195444 CTCCTGATGGGACAGGTGCAGGG - Intronic
1040918388 8:52587482-52587504 CACCTGCTGAGTCAGAAGCCTGG + Intergenic
1042937342 8:74073212-74073234 CTTCTCCTGAGCCAGGTGTATGG - Intergenic
1045041492 8:98228563-98228585 CTCTTGCAGAGCCAAGTTCCTGG - Intronic
1046712035 8:117520926-117520948 GGCCTGCTGAGCCTGGGGCCCGG - Exonic
1047522939 8:125609416-125609438 CTCCTCCTGTGCCAGCTGCTGGG + Intergenic
1047695755 8:127402024-127402046 TCCCAGCTGAGCCAGGAGCCTGG - Intergenic
1047730649 8:127725202-127725224 CCCCAGTCGAGCCAGGTGCCCGG - Intergenic
1048653764 8:136512059-136512081 CTCCTGCTGAACAGGGTCCCAGG - Intergenic
1048986556 8:139738035-139738057 CTTCTCCCAAGCCAGGTGCCAGG + Intronic
1049066596 8:140321259-140321281 ACCCTGAGGAGCCAGGTGCCAGG + Intronic
1049168411 8:141141437-141141459 CTCCTGGTGAGCCGGGGGACCGG + Intronic
1049191231 8:141288890-141288912 CTTCTGCTGTGCCAGCTGCCTGG - Intronic
1049381490 8:142318616-142318638 CTCCTGCTGTGCCGTGTGCCTGG + Exonic
1050048745 9:1576036-1576058 CCCCTGTGGACCCAGGTGCCAGG - Intergenic
1050575582 9:6991773-6991795 CTCCTGCAGTCCCAGCTGCCTGG + Intronic
1050831191 9:10015999-10016021 CTTCTCCTGAGGCAGGTACCAGG + Intronic
1051184056 9:14440045-14440067 CACCTGGTGAGCCAAATGCCTGG - Intergenic
1055404697 9:75962377-75962399 ATCCAGCTGGGCCAGGGGCCAGG + Intronic
1057302927 9:93896839-93896861 GGCCTGCTGAGGCTGGTGCCAGG - Intergenic
1057501985 9:95603318-95603340 CTCCAGCTGAGGCAGGGGCCAGG - Intergenic
1057670053 9:97078608-97078630 CCCCTGCAGAGGCAGGAGCCAGG + Intergenic
1058013373 9:100003548-100003570 CACCTGCTGACCCAGGCACCAGG - Intronic
1058938982 9:109795766-109795788 TTACTGCTGAGCCCTGTGCCAGG + Intronic
1059338339 9:113583159-113583181 CTCCTGCTTTGGCAGGTGCCAGG - Intronic
1059344036 9:113616269-113616291 CTCCTCCAGAGCCTGGAGCCTGG - Intergenic
1059613516 9:115924368-115924390 CTGCTTCTGACCCAGGTGTCTGG - Intergenic
1060407377 9:123379557-123379579 CTCCTGTAGAGGCAGGGGCCAGG - Intronic
1060547622 9:124470360-124470382 GTCCTGCTGAGCCATGGTCCCGG + Intronic
1060766563 9:126298466-126298488 CTCCTCCTGACCCAGGAGCACGG + Intergenic
1061238790 9:129357464-129357486 GTCCCGCTCAGCCAGGAGCCAGG - Intergenic
1061882121 9:133573786-133573808 CTCCTGATGGGGCAGGGGCCTGG - Intronic
1062105871 9:134754475-134754497 CTGCCTCTGAGCCAGCTGCCTGG + Intronic
1186026643 X:5320603-5320625 CTCAGGGTTAGCCAGGTGCCTGG + Intergenic
1186182088 X:6983349-6983371 CTTCTGCTGAGTCAGTTCCCGGG + Intergenic
1186907345 X:14125909-14125931 TTCCTGATGATCCAAGTGCCAGG - Intergenic
1189916903 X:45864412-45864434 CTCCTGCCAAGACAGGAGCCAGG + Intergenic
1191210080 X:57875644-57875666 TGCCTGCAAAGCCAGGTGCCTGG - Intergenic
1191214013 X:57916968-57916990 CTGCTGCTGATCCAGCTGCAGGG - Intergenic
1194261886 X:91705884-91705906 CTACTGAAGAGCAAGGTGCCTGG + Intergenic
1196649090 X:118150553-118150575 CTCTTGCTGAGTCAGTTGCTGGG - Intergenic
1197846808 X:130811456-130811478 CACCTGCTGACCCAGGCACCAGG + Intronic
1198138724 X:133781398-133781420 CTAGAGCTGAGCCAGGTGTCGGG + Intronic
1199163454 X:144642562-144642584 CTGCTGCTGGGCCAGTTCCCAGG + Intergenic
1199534693 X:148889302-148889324 GCCATGCTGAGCCAGGTGACAGG + Intronic
1200580534 Y:4944673-4944695 CTACTGAAGAGCAAGGTGCCTGG + Intergenic
1201529938 Y:14980513-14980535 CTTCTCCTGAGGCAGTTGCCAGG - Intergenic