ID: 1183096102

View in Genome Browser
Species Human (GRCh38)
Location 22:35553212-35553234
Sequence CTGTGTGTGCAGAAGGTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 475}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183096102_1183096111 -9 Left 1183096102 22:35553212-35553234 CCCACCACCTTCTGCACACACAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1183096111 22:35553226-35553248 CACACACAGCGGTGGGGAGGCGG 0: 1
1: 0
2: 3
3: 48
4: 392
1183096102_1183096113 -7 Left 1183096102 22:35553212-35553234 CCCACCACCTTCTGCACACACAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1183096113 22:35553228-35553250 CACACAGCGGTGGGGAGGCGGGG 0: 1
1: 0
2: 1
3: 27
4: 290
1183096102_1183096120 29 Left 1183096102 22:35553212-35553234 CCCACCACCTTCTGCACACACAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1183096120 22:35553264-35553286 ACCCAGAACTGAGCCTGGGAGGG 0: 1
1: 0
2: 3
3: 25
4: 314
1183096102_1183096112 -8 Left 1183096102 22:35553212-35553234 CCCACCACCTTCTGCACACACAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1183096112 22:35553227-35553249 ACACACAGCGGTGGGGAGGCGGG 0: 1
1: 0
2: 2
3: 23
4: 349
1183096102_1183096115 5 Left 1183096102 22:35553212-35553234 CCCACCACCTTCTGCACACACAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1183096115 22:35553240-35553262 GGGAGGCGGGGAGGAGCAGCTGG 0: 2
1: 0
2: 11
3: 185
4: 1578
1183096102_1183096117 24 Left 1183096102 22:35553212-35553234 CCCACCACCTTCTGCACACACAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1183096117 22:35553259-35553281 CTGGGACCCAGAACTGAGCCTGG 0: 1
1: 0
2: 6
3: 64
4: 418
1183096102_1183096118 25 Left 1183096102 22:35553212-35553234 CCCACCACCTTCTGCACACACAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1183096118 22:35553260-35553282 TGGGACCCAGAACTGAGCCTGGG 0: 1
1: 0
2: 2
3: 35
4: 280
1183096102_1183096114 -4 Left 1183096102 22:35553212-35553234 CCCACCACCTTCTGCACACACAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1183096114 22:35553231-35553253 ACAGCGGTGGGGAGGCGGGGAGG 0: 1
1: 0
2: 5
3: 83
4: 958
1183096102_1183096116 6 Left 1183096102 22:35553212-35553234 CCCACCACCTTCTGCACACACAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1183096116 22:35553241-35553263 GGAGGCGGGGAGGAGCAGCTGGG 0: 1
1: 1
2: 4
3: 77
4: 796
1183096102_1183096119 28 Left 1183096102 22:35553212-35553234 CCCACCACCTTCTGCACACACAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1183096119 22:35553263-35553285 GACCCAGAACTGAGCCTGGGAGG 0: 1
1: 0
2: 1
3: 20
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183096102 Original CRISPR CTGTGTGTGCAGAAGGTGGT GGG (reversed) Exonic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900768383 1:4520669-4520691 CTGTGTGTGGTGGAGATGGTGGG - Intergenic
900945069 1:5826441-5826463 TCGGGTGTGCAGTAGGTGGTTGG + Intergenic
901120583 1:6889722-6889744 GTGTGTGTGTAGAAGATGCTGGG + Intronic
901921347 1:12539992-12540014 CCGTGTGAGCAGGAGGTGGGTGG + Intergenic
902620231 1:17646551-17646573 GTGTGTGTGCACATGGAGGTAGG - Intronic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
902797146 1:18807284-18807306 CTCTGTGTCCAGCAGGTGGAAGG - Intergenic
903071150 1:20727515-20727537 CTGTGGGCGCTGAAGGTGGGTGG - Exonic
903607002 1:24582156-24582178 CGATGTGTGCAGGGGGTGGTCGG - Intronic
903929953 1:26856381-26856403 GTGTGTGTGCTGGTGGTGGTAGG + Exonic
904958396 1:34308684-34308706 CTGTGTGCTCAGAGTGTGGTTGG - Intergenic
905115047 1:35631431-35631453 CTGAGTGTACAAAAGATGGTGGG - Intronic
905195002 1:36269155-36269177 CTGTGTGTTCAGAAATTGGAGGG - Intronic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
906150167 1:43582963-43582985 CTGTGTGGGCAGATGAAGGTTGG + Intronic
907291152 1:53413832-53413854 CTGTGTGCTCAGGAGGTGGGAGG - Intergenic
909288699 1:73854686-73854708 CTGTATCTGCAGGTGGTGGTGGG - Intergenic
910438895 1:87232178-87232200 CTGTGGGTACAGATGGTAGTAGG - Intergenic
910545755 1:88415683-88415705 TTGAGTGGCCAGAAGGTGGTGGG + Intergenic
914442848 1:147722304-147722326 CAGTGAGTGGAGAAGGTGATGGG + Intergenic
915269303 1:154742291-154742313 GTGTGTGGGCAGTAGGTGGATGG - Intronic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915815992 1:158965536-158965558 CTGTGTTCTGAGAAGGTGGTTGG - Intronic
916726422 1:167527600-167527622 ATCTGTGTGCAGGTGGTGGTGGG - Intergenic
917473704 1:175349817-175349839 CTGGCTGTGGAGAAGGAGGTAGG - Intronic
918028478 1:180778509-180778531 CTGTGTTTGGAGCAGGTAGTGGG + Intronic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
920034611 1:203057875-203057897 CTGTGTGTGGAGGAAGGGGTTGG + Intronic
920046937 1:203139319-203139341 CTGTGGGCGCAGATGCTGGTAGG + Intronic
920201608 1:204263038-204263060 CTGTGTGTGCAGAACTCGCTGGG + Intronic
920827039 1:209431935-209431957 CTGTCTGTGCAGCAGGTGCAAGG + Intergenic
921929849 1:220746359-220746381 CTGTGCATGCAGCAGGTGGCGGG - Intergenic
921972705 1:221167709-221167731 CTATGTTTCCAGTAGGTGGTGGG + Intergenic
922054746 1:222030356-222030378 ATGTGTTTGCAGAAGGTTTTTGG + Intergenic
922258525 1:223914840-223914862 GTGTGTGTGCATGTGGTGGTGGG + Intergenic
923186132 1:231575232-231575254 CTGTGAGTGCAGGTGTTGGTAGG - Intronic
923460507 1:234205896-234205918 CTGGGGGTGCAGGGGGTGGTGGG + Intronic
924152216 1:241141000-241141022 CTGTTTGGGGTGAAGGTGGTGGG - Intronic
1063727242 10:8651373-8651395 CTTTGTCTGCAGATGATGGTAGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064548472 10:16475009-16475031 CTGTGTGTTCACATGGTGGAAGG + Intronic
1065167748 10:22998310-22998332 CTGTGTTTGCAGAACGCAGTGGG - Exonic
1066108980 10:32179784-32179806 GTGTGTGTGCAGATGTGGGTGGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067005890 10:42661613-42661635 CTGAGTGTGCAGAACCTTGTGGG + Intergenic
1067221486 10:44347343-44347365 CTGAGAGGGCAGTAGGTGGTGGG - Intergenic
1069046023 10:63744144-63744166 CTGTTTATGCAGAATGTGTTAGG - Intergenic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1070183290 10:74035562-74035584 CTATGTGTCCACTAGGTGGTGGG - Intronic
1070567590 10:77615424-77615446 CTGAGGCTGCAGAAGGTGGGTGG + Intronic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG + Intronic
1073073091 10:100807140-100807162 CAGTGTCTGCAGAAAGTGTTGGG - Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1075087575 10:119423722-119423744 GTGTGTGTGCAGGATGGGGTGGG - Intronic
1075619041 10:123912288-123912310 GTGAGTGTGCAGATGGTGGGCGG + Intronic
1075835774 10:125451487-125451509 GTGTGTGTGGAGGAGGCGGTGGG - Intergenic
1076740332 10:132479667-132479689 CTGTGGCTGCAGAAAGTGCTTGG + Intergenic
1076867778 10:133176483-133176505 CTGTGTGTGCAGTGCCTGGTAGG + Intronic
1077324892 11:1959427-1959449 GTGTGTGTGCCTGAGGTGGTGGG - Intronic
1077615821 11:3672818-3672840 TTGTGTGTTAGGAAGGTGGTTGG - Intronic
1077936666 11:6795254-6795276 CTGTGTGTGCAGATGGCTGCTGG - Exonic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1079213258 11:18483034-18483056 GTGTGTGTGTAGCAGGGGGTGGG + Intronic
1080250551 11:30228560-30228582 TTGTGGGTGCAGATGCTGGTGGG - Intergenic
1080634552 11:34112209-34112231 ATGTGTGTGCTGCAGGTGGGTGG + Exonic
1080681251 11:34478163-34478185 CTGCGTGTCCAGAAGGCAGTAGG + Intergenic
1081280206 11:41200552-41200574 CTGTTTTTGCAGAAGTAGGTAGG - Intronic
1082731394 11:56802360-56802382 GTCTGTGTGCAGCTGGTGGTGGG - Intergenic
1082865977 11:57900525-57900547 CTGGGTGTGTACAGGGTGGTTGG + Intergenic
1082904596 11:58292325-58292347 CTGTGCGTGCAGATGCTGGGCGG - Intergenic
1083002695 11:59310147-59310169 CTCTGCGTGCAGATGGTGGCAGG - Intergenic
1083055825 11:59818742-59818764 CAGTTTATGCAGCAGGTGGTAGG + Intergenic
1083190860 11:61051375-61051397 GTGTCTGTGCAGAAGGGGGTGGG - Intergenic
1083275460 11:61594626-61594648 GTGTGGGTGCAGAGGCTGGTGGG + Intergenic
1083776534 11:64896843-64896865 CTGGGTGTGGACAAGGTGCTGGG - Exonic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085246253 11:75103958-75103980 GTGTGGGTGCAGAGGCTGGTAGG - Intronic
1085339809 11:75723823-75723845 CTGGGTGTGCAGTAGGCAGTGGG - Intronic
1085390675 11:76180555-76180577 GTGTATGTGCAGGAGGTGGTGGG + Intergenic
1085807500 11:79649784-79649806 CTTTGTGAGTAGAATGTGGTCGG - Intergenic
1085900568 11:80695056-80695078 CTATGTATGGAGAAGGAGGTGGG - Intergenic
1086346207 11:85900143-85900165 CTGTGTGTGCTATAGATGGTGGG + Intronic
1086882615 11:92167076-92167098 GTGTGTGTGTCGATGGTGGTGGG - Intergenic
1087242743 11:95797827-95797849 CTGACTGGGCAGAGGGTGGTCGG + Intronic
1087292212 11:96332031-96332053 CTGTGGGTGCAGAATTTGGGAGG + Intronic
1087752993 11:102025849-102025871 CTATGTGTGCAGTAGGGGGGAGG + Intergenic
1088732258 11:112693901-112693923 GGGTGTGAGCAGAAGGCGGTAGG - Intergenic
1089586766 11:119514592-119514614 CTGTGTGTGTTGAGGGGGGTAGG + Intergenic
1089814565 11:121160853-121160875 TTGTGTAGGCAGAAGTTGGTGGG + Intronic
1090369480 11:126238356-126238378 CTGTGTGTACATAAGGGGCTTGG + Intronic
1090379689 11:126317773-126317795 CTGTGTGTGGAGAAGTGGGGGGG + Intronic
1090759683 11:129825479-129825501 CTGTCTGTTCAGCAGGTTGTTGG + Intronic
1090924209 11:131235479-131235501 ATGTGTTTGCAGGAGGTAGTGGG - Intergenic
1091013228 11:132025273-132025295 CTGTGTGCCCAGAATTTGGTGGG + Intronic
1091297654 11:134485364-134485386 GTGTGTGTGTAGGTGGTGGTGGG + Intergenic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1202807874 11_KI270721v1_random:14606-14628 GTGTGTGTGCCTGAGGTGGTGGG - Intergenic
1091782882 12:3224998-3225020 CTGTGTGTGCAGCTGGTGGTGGG + Intronic
1093308477 12:17547912-17547934 CAGTGTGTGCACATGGTTGTGGG + Intergenic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097680868 12:62647768-62647790 CTGTGTGGGCTGGAGGAGGTGGG + Exonic
1099145269 12:79035608-79035630 CTTTGTGGGCAGGAAGTGGTGGG - Intronic
1099325329 12:81208009-81208031 CTTTGTGTTCAGGAGATGGTAGG - Intronic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1099899736 12:88693086-88693108 TCGTGTGTGCAGAAGGGGGAGGG + Intergenic
1100390461 12:94142326-94142348 CTAAGGGTTCAGAAGGTGGTGGG - Intergenic
1102361993 12:112296138-112296160 GTGTAGGTGCAGCAGGTGGTAGG + Intronic
1102454076 12:113060802-113060824 CTGTGAGAGCAGAAGTGGGTAGG + Intronic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1103897604 12:124283787-124283809 CTGTGTGTGAAGTTGGTGATGGG + Intronic
1103980338 12:124732963-124732985 CTGAGTTCCCAGAAGGTGGTCGG + Intergenic
1104399239 12:128461993-128462015 CTGTGTGTTCAGCAGAAGGTGGG + Intronic
1105607317 13:21936902-21936924 GTGTGTGTAGAGAAGGTGGGTGG + Intergenic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1107750199 13:43557276-43557298 ATGTATGGCCAGAAGGTGGTAGG + Intronic
1108590915 13:51912225-51912247 CAGTGTGTGCAGCAGGTATTCGG + Intergenic
1108732503 13:53249234-53249256 CTGTTTGTGGAGAAGGGGTTAGG - Intergenic
1109967595 13:69721369-69721391 CAATGTGTGCCAAAGGTGGTTGG - Intronic
1110780986 13:79464734-79464756 CAGTGTTTTCAGACGGTGGTGGG + Intergenic
1112025973 13:95411463-95411485 CTGTCTGAGCATAAGGTGGGGGG + Intergenic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1112298229 13:98207895-98207917 GTGTGTGTGGAGGTGGTGGTCGG - Intronic
1113065418 13:106369039-106369061 CTGTGTGTGCATGAGTTTGTGGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1113746279 13:112747093-112747115 AGGAGTGTTCAGAAGGTGGTAGG + Intronic
1113758590 13:112831973-112831995 CTGTGTGTGCACACGGTGTCTGG - Intronic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1116159889 14:41254341-41254363 CTTGGTGTTCAGGAGGTGGTGGG + Intergenic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1117712709 14:58548960-58548982 TTGTGTGTGGAGATGGGGGTGGG + Intronic
1118170889 14:63387420-63387442 CTGTGTGTGCAGAAGGACAGTGG - Intronic
1118994559 14:70824060-70824082 CTGTGTTTGCAGGAAATGGTGGG - Intergenic
1120214993 14:81672193-81672215 CTCTCTGTGCAGCATGTGGTAGG - Intergenic
1121582575 14:95041846-95041868 GTGTGTGGGCAGTATGTGGTGGG - Intergenic
1121991423 14:98561607-98561629 CTGTATGTGTGGAAGGTAGTGGG + Intergenic
1122000571 14:98648240-98648262 CTGTGTGTTCATAAAGTGCTTGG + Intergenic
1122141611 14:99666387-99666409 CTGTGTGTGCAGAGGGTTGGGGG + Intronic
1123128757 14:105968800-105968822 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1123409283 15:20044963-20044985 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1123518614 15:21051671-21051693 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1124217752 15:27823024-27823046 CTGTGTGTACGGAATGAGGTAGG + Intronic
1124887955 15:33704458-33704480 GTGTGTATGCAGGAGGTGGCTGG - Intronic
1126033690 15:44526780-44526802 CTGTGTGAGCTGAAGGGGCTGGG - Exonic
1127414364 15:58743330-58743352 GTTTGTGTGGAGAAGGTTGTGGG - Intronic
1128541148 15:68534213-68534235 ATGTGTATGCACAAGGAGGTGGG - Intergenic
1128546844 15:68574095-68574117 CTGTGTGTGCAAGAGCTGCTGGG + Intergenic
1128772336 15:70291755-70291777 CTAGGTGTGCAGAAGGTGCTTGG - Intergenic
1128831911 15:70777220-70777242 CTGTGGGTGGAGAGGGTTGTGGG + Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129685290 15:77682676-77682698 CTTTGTGCCCAGAAGGGGGTGGG - Intronic
1130652069 15:85767888-85767910 CTGGGTGGGCAGCAGGTGGCTGG - Intronic
1130723105 15:86409463-86409485 CTGTGTATGCAGGCGATGGTGGG - Intronic
1133317530 16:4893674-4893696 CTGTGGGTGCAGGGGGTGGTGGG - Intronic
1133467003 16:6036990-6037012 CTGTGTGTGTTGGAGGTGGGGGG + Intronic
1134083160 16:11338425-11338447 CTGTGTCTTCACAAGGTGGAAGG + Intronic
1134291290 16:12904109-12904131 CTGTGGTTGCGGAAGGTGGGCGG - Intronic
1134323085 16:13181504-13181526 ATGTGTCTGGAGAAGTTGGTAGG + Intronic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1136871525 16:33812073-33812095 CTGTGTTTGGAGAAAGGGGTGGG - Intergenic
1139641300 16:68293632-68293654 CTGTGTGAGAAGAGGGTGCTGGG - Intronic
1139642342 16:68301309-68301331 CTGGATGTGCAGAAGGAGTTCGG - Exonic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1139970179 16:70769425-70769447 CGCTGTGGGAAGAAGGTGGTGGG + Intronic
1140220695 16:73041667-73041689 CAGTGTGTGCGGCAGGAGGTTGG - Intronic
1142205208 16:88779677-88779699 CTGTGTGTGCAGCATGAGGGAGG + Intronic
1203100647 16_KI270728v1_random:1303985-1304007 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1143251518 17:5526594-5526616 CTGTGTGTGCTGAAGGAGATGGG + Intronic
1143703950 17:8683602-8683624 GTGTGTGTGGTGATGGTGGTGGG - Intergenic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146910200 17:36643528-36643550 CTGTGGGTGGAGAGGATGGTGGG + Intergenic
1147537972 17:41333268-41333290 CAATGTTTGCAGGAGGTGGTGGG + Intergenic
1147539515 17:41345479-41345501 GTGTTTGGGAAGAAGGTGGTGGG - Intergenic
1149035090 17:52125046-52125068 CTGTGTGTGCAAAAGCTGTGAGG - Intronic
1149084171 17:52694379-52694401 CTGTGTTTTCACAAGGTGGAAGG - Intergenic
1150481983 17:65517755-65517777 CTGGGTGTGGAGGGGGTGGTAGG - Intergenic
1150549671 17:66197702-66197724 CTGGTAGTACAGAAGGTGGTGGG + Intergenic
1150964943 17:69957398-69957420 CTGTGAGTTCAGAAAGTGTTTGG - Intergenic
1151393889 17:73807002-73807024 CTGTGTCTTCATATGGTGGTAGG + Intergenic
1152268862 17:79312135-79312157 TTGTGTGTGCACAACGAGGTGGG + Intronic
1152437772 17:80286669-80286691 ATGTGGGTGCAGGAGGTGGGGGG + Intronic
1153222173 18:2871415-2871437 CTGTGTGTGCAAAACGTACTTGG + Intronic
1153321088 18:3774918-3774940 CAGGGAGTGCAGGAGGTGGTGGG - Intronic
1154130935 18:11736545-11736567 CCCTGTTTGCAGAAGGTGCTTGG + Intronic
1155185437 18:23383205-23383227 CTCTGTGAGCAGCAGGTGGCTGG + Intronic
1155318904 18:24598983-24599005 CTGTGTGTTTAGAGGTTGGTTGG - Intergenic
1156111912 18:33738577-33738599 CTGTCTGTGCAGAAACTGGAAGG - Exonic
1156231180 18:35155399-35155421 GTGTGTGTGCGGATGGGGGTGGG + Intergenic
1156351271 18:36303341-36303363 CTCTCTGTGCAGATGGGGGTGGG + Intronic
1157710777 18:49848306-49848328 ATGTGGGTGCTGATGGTGGTGGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158836335 18:61334380-61334402 CTGTGGGAGGAGAATGTGGTGGG + Intronic
1158934203 18:62349505-62349527 TTTTGGGTGCAGAGGGTGGTTGG + Intronic
1159748341 18:72268480-72268502 GTATCTGTGCAGAAGGTGTTTGG - Intergenic
1160283880 18:77520979-77521001 CTGTGTGTGAAGCCTGTGGTAGG - Intergenic
1160951357 19:1669067-1669089 CTGTGTGTGCACTAGGGGGGCGG + Intergenic
1161451714 19:4350064-4350086 TTGTGGGGGAAGAAGGTGGTTGG + Intronic
1161520862 19:4722972-4722994 CTGTGTGGGAAGAAGGTAGGCGG + Intronic
1161535927 19:4818442-4818464 CTGGGCGTGCAGAAGGCGGGGGG - Exonic
1161587283 19:5112525-5112547 CTGTTTCTGCAGAGCGTGGTGGG - Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1163727509 19:18931300-18931322 GTGTGTGGGCACAAGGAGGTGGG - Intronic
1164523550 19:28997213-28997235 CTGTGTGTGTAAACTGTGGTTGG + Intergenic
1165330215 19:35137542-35137564 CTGTGTGTACACAAGCTTGTTGG + Intronic
1165354922 19:35298446-35298468 GTGTGTGTGCAGTGTGTGGTGGG - Intronic
1166175292 19:41064300-41064322 ATGTGTGTGGTGATGGTGGTTGG + Intergenic
1166265633 19:41682596-41682618 GGGTGTGTGGAGAAGGTGCTTGG - Intronic
1166346781 19:42171326-42171348 CTGTGTGTGAATAAGGGGATAGG + Intronic
1166555643 19:43697965-43697987 GTGTGTGTGAAGAAGGTAATGGG + Intergenic
1166668706 19:44697324-44697346 CTGTTTGTGCAGTGGGTGGGGGG - Intergenic
1166683657 19:44782267-44782289 ATGGGTGTGAAGGAGGTGGTTGG + Intronic
1168422280 19:56212417-56212439 CTGTGTCTGGAGAAGGATGTTGG - Intergenic
925675895 2:6360679-6360701 CTGTGTCTGCAGGAGGAGATCGG + Intergenic
925807700 2:7667596-7667618 CTGTGTGTGGACAAGGTGCCTGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
927429363 2:23014005-23014027 CTGTGTGTGCAGCAGATGCCTGG - Intergenic
929071648 2:38037575-38037597 ATGTGTGTGCAGCACGTGTTAGG - Intronic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
929559191 2:42945241-42945263 CTGTATGTCCAGAATGCGGTAGG - Intergenic
929591033 2:43146356-43146378 CTGTGTCTCCACCAGGTGGTGGG + Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
932337368 2:70938765-70938787 CTGTTTGGGCAGAAGATGTTGGG + Intronic
932813493 2:74843605-74843627 CTGAGTGGGCAGGAGGTGGGTGG - Intronic
934020035 2:87939480-87939502 CTGTGTGACCAGATGGTGCTAGG - Intergenic
934541728 2:95180930-95180952 CTGGGAGTGAAGAAGGTGGCAGG - Intronic
934980233 2:98833410-98833432 CTGTGTGTGCAGCAGGCTGAGGG + Intronic
936327994 2:111522172-111522194 CTGTGTGTTTAGTAAGTGGTGGG - Intergenic
937471447 2:122177130-122177152 CTGTGAGTGGAGCAGATGGTTGG - Intergenic
939213185 2:139204995-139205017 GTGTGTGTGCAGAAACTGGGGGG + Intergenic
939630681 2:144523733-144523755 GTGTGTGTGGAGGAGGTGGGGGG + Intronic
941418124 2:165247031-165247053 ATGTGGGTGCAGAACCTGGTAGG - Intronic
942232342 2:173872252-173872274 CTTTGTGTGCATAAGGTGCACGG + Intergenic
942458262 2:176152243-176152265 CTGTGGGCGCAAAAGGGGGTGGG + Intronic
942699638 2:178690467-178690489 CTTTGTGTGCAGAATTTTGTGGG + Intronic
942707604 2:178794229-178794251 CTTTCTGAGCAAAAGGTGGTCGG - Intronic
942977698 2:182038712-182038734 CTGTGTGTGCCTAATGTGTTTGG + Intronic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
944280772 2:197894010-197894032 GTGTGTGTGCAGTAAGGGGTGGG + Intronic
945256080 2:207804369-207804391 GTGTGTGTGCAGAAGGAGACAGG + Intergenic
945395244 2:209307853-209307875 CTGGGAGTGCAGAAGGGGGCAGG + Intergenic
945721491 2:213422664-213422686 TTGTGTGTACAGAGGGTGGGAGG - Intronic
947677586 2:231997273-231997295 CTGTGTTTGCAAAAAGTGCTGGG + Intronic
1168910566 20:1443652-1443674 CTGGGTGTGCACAAGGGGGCAGG + Exonic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1171190107 20:23152716-23152738 CTGTGCTTGGAGAAGGTGGCTGG - Intergenic
1171256083 20:23690022-23690044 CAGTGTGTGTAGAGGATGGTAGG + Intergenic
1172820473 20:37728838-37728860 CTGTGTGTGAGGGAGGAGGTTGG + Intronic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173350086 20:42236888-42236910 CTGTGTGAATAGAATGTGGTAGG + Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1174059814 20:47825099-47825121 CTGTGTGTCCAGCAGCTGGCAGG + Intergenic
1174072057 20:47906172-47906194 CTGTGTGTCCAGCAGCTGGCAGG - Intergenic
1174147192 20:48460154-48460176 CTGTGTGTCCAGCAGCTGGCAGG + Intergenic
1174151985 20:48492497-48492519 CTGTGTGTCCAGCAGCTGGCAGG + Intergenic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175460129 20:59146185-59146207 TTGTGTGTGTGGAGGGTGGTGGG - Intergenic
1175801825 20:61805366-61805388 CTGTGTTGGCAGATGGAGGTGGG + Intronic
1175885541 20:62288384-62288406 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885547 20:62288407-62288429 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885565 20:62288475-62288497 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885577 20:62288520-62288542 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885589 20:62288565-62288587 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1176057827 20:63158183-63158205 CTTAGTGTTCAGCAGGTGGTTGG + Intergenic
1176089435 20:63312403-63312425 CTCTGTCTGCAGCAGGTGGGAGG - Exonic
1176111658 20:63413706-63413728 CTGTGTGTGGAGCTGGTGGGCGG - Intronic
1176299298 21:5091010-5091032 CTGTGGGTGCAGGAGGTTGGGGG + Intergenic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1178498965 21:33110099-33110121 CTGCGGGTGCAGAGGGTTGTTGG + Intergenic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1178704933 21:34865318-34865340 GTGTGTGTTCAGCAGGTGATGGG + Intronic
1179419993 21:41227822-41227844 CTGTGTGTGCAGCAGAGGTTTGG + Intronic
1179607758 21:42528502-42528524 CTGTGTGTCCAGAGAGGGGTGGG - Intronic
1179857728 21:44170937-44170959 CTGTGGGTGCAGGAGGTTGGGGG - Intergenic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1182112710 22:27734643-27734665 CTGTGTGTGCAGAAGTGGATGGG - Intergenic
1182326898 22:29520036-29520058 TTGTGGGTGCAGAAGCTGGGTGG - Exonic
1182567446 22:31210916-31210938 CTGAGTGTGCACAAAGTGCTGGG - Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1183812826 22:40272222-40272244 CTGTCTGTGCACAAGGGGGAGGG - Intronic
1185225663 22:49650610-49650632 CTGTGTGTGGAGAAGGGTGGAGG + Intronic
949523844 3:4883305-4883327 CTGTGTGTGTCTAGGGTGGTTGG + Intronic
949726473 3:7052550-7052572 CTGTGTGTGTATATGGAGGTGGG - Intronic
950040793 3:9917900-9917922 CTGTGTGTGGAGGAGCGGGTGGG - Intronic
950303627 3:11901821-11901843 GGGTGGGTGCAGAAGGTGATGGG + Intergenic
950449747 3:13058961-13058983 CTCTGGGTGCAGGAGGTGGATGG + Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952009500 3:28884294-28884316 CTGGATGTGCAGAACATGGTTGG - Intergenic
952466780 3:33597470-33597492 GTGTGTGTGCAGAAGTTGTGGGG + Intronic
952750014 3:36817425-36817447 CTGTATGTGCTGGAGGAGGTAGG - Intergenic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
954057136 3:48036283-48036305 CTGTGGGTGGAAAAGGTGGGAGG - Intronic
954214138 3:49115151-49115173 CTGGGTGTGCAGTGGGTGCTAGG - Intronic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
954590024 3:51775332-51775354 CTCCGTGTGCAGAGGGTGGCAGG - Intergenic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
955607681 3:60723175-60723197 CTATATGTGCAAAAGGTGTTAGG - Intronic
955784933 3:62527439-62527461 CTGTGTGTGCTGGGGGTGGGGGG + Intronic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG + Intergenic
958180245 3:90050615-90050637 CTATGTGTGTGGAGGGTGGTAGG + Intergenic
959289670 3:104457821-104457843 GTGTGTGTGCAAAATGAGGTCGG - Intergenic
960212408 3:114985979-114986001 CTTTGTTTACAGAAGGGGGTGGG + Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
964254085 3:154755049-154755071 CATTGTGTGAAGAATGTGGTAGG - Intergenic
964428695 3:156580857-156580879 CAGTGTGTGTAGAAGGGTGTGGG - Intergenic
964683163 3:159364890-159364912 CTGTGTGTGCACAGGATTGTTGG + Intronic
966937367 3:184719809-184719831 CTGTTGGGCCAGAAGGTGGTTGG - Intergenic
967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG + Intergenic
967326079 3:188241162-188241184 CTCTAGGAGCAGAAGGTGGTGGG + Intronic
967519294 3:190410235-190410257 AAGTGTGTGCATAAGGTGGAAGG - Exonic
969328060 4:6455413-6455435 CTGGGGGTGCAGATGGTGGCAGG - Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969883684 4:10196638-10196660 CTCTGTCAGCAGAAGGTGGGGGG + Intergenic
969894789 4:10293278-10293300 CCGTATGAGCAGAAGGTGTTAGG - Intergenic
969909546 4:10430851-10430873 GTGTGTGTGAAGCAGGTGGGTGG - Intergenic
969929759 4:10619575-10619597 TTGTGTGTGCAGGAGGGGTTGGG + Intronic
971576150 4:28278253-28278275 GTATGTGTGCACAAGGAGGTGGG + Intergenic
971798702 4:31260429-31260451 CTCTGTGGGCAGAAGGTAATGGG + Intergenic
972302090 4:37794013-37794035 TTGTGTGAGCAGTGGGTGGTTGG - Intergenic
972412639 4:38808281-38808303 ATGTGTGTGCAGAAAGAGGTAGG + Intronic
973759917 4:54106126-54106148 CTGTGTTTGGAGAAGATGGGAGG - Intronic
976437319 4:85033082-85033104 CTGTGTTTTCACAAGGTGGAAGG + Intergenic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
976600938 4:86936467-86936489 CGGTGTGTGTAGAAGGTAGGTGG + Intronic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
977364649 4:96052592-96052614 CTGTGTGTGCAGTTTGTGGGTGG - Intergenic
977668800 4:99671531-99671553 CTATATGTGTAGGAGGTGGTTGG - Intergenic
978733209 4:112055619-112055641 CTGTGTTTTCAGAAGCTGCTAGG - Intergenic
979263138 4:118671003-118671025 GTGTGTGTGCATGTGGTGGTGGG - Intergenic
979838728 4:125408618-125408640 CTGTTCGAGCAGAAGATGGTGGG + Exonic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
982536581 4:156614426-156614448 CTGTGTGTGAAGCAGGAGGCGGG + Intergenic
982536853 4:156617652-156617674 CTGTGTGTCCAGAAGTTGCAGGG - Intergenic
984652607 4:182286550-182286572 CTGTAGATGCAGAAGGTTGTGGG + Intronic
985168615 4:187124478-187124500 TTCTGTGTGCAGGAGGTGGACGG - Intergenic
985648802 5:1098088-1098110 CTGGGTGTGCAGAGGGTTGGAGG - Intronic
985702103 5:1379677-1379699 TTTTGTGTCCAGAAGTTGGTGGG + Intergenic
986104837 5:4649883-4649905 CCGTGTTTGCAGCAGGTGCTGGG + Intergenic
986348066 5:6852892-6852914 CAGGCTGTGCAGAAGGTGCTGGG + Intergenic
986517902 5:8582441-8582463 CTGTGTGTGAGGATGGTTGTTGG + Intergenic
986631112 5:9775168-9775190 CTTTGTGTGCAGAAAGGGGAGGG - Intergenic
987541100 5:19257142-19257164 CGGTGTGTGCAAAAGCGGGTAGG + Intergenic
988713236 5:33799420-33799442 CTGTGTGTGCAAGAGTTGCTGGG + Intronic
989579735 5:43020649-43020671 CTCTGGGTTCAGAAGGTTGTGGG + Intergenic
989975935 5:50587181-50587203 CTGTGTGTATTGGAGGTGGTAGG + Intergenic
990325767 5:54673921-54673943 CTGTGTGTGTAGTAGGTGGGTGG - Intergenic
990512854 5:56504472-56504494 ATGTGTGTGCAATGGGTGGTAGG + Intergenic
993364484 5:87019529-87019551 CTATGTGTGCAGCAGTGGGTGGG + Intergenic
994087004 5:95770001-95770023 CAGTGTTTGGAGAAGGGGGTAGG + Intronic
995368344 5:111389176-111389198 CTGTGTCTGCACATGGTGGAAGG + Intronic
995511890 5:112918772-112918794 CTGTGTGAGCAAAGAGTGGTGGG - Intronic
998150260 5:139753087-139753109 CTGAGTTTGCTGATGGTGGTGGG - Intergenic
998329094 5:141307702-141307724 GTGTGTGTGCAGGGTGTGGTGGG + Intergenic
998351928 5:141507751-141507773 CTGTGTGGGCCAAAGGTGGGAGG - Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999622879 5:153490414-153490436 CTGTGTGTGCAGAAAGGTGGAGG - Intronic
1000166796 5:158657544-158657566 GTGTGAGTGAGGAAGGTGGTAGG - Intergenic
1001939667 5:175731593-175731615 CTGTGTGTGTGTATGGTGGTGGG - Intergenic
1002599361 5:180345550-180345572 ATGTGGCTGGAGAAGGTGGTGGG - Intronic
1002805684 6:571996-572018 GTGTGACTGCAGAAGGTGGACGG + Intronic
1003891293 6:10565977-10565999 CTGTGTTTGGTGAAGGTGCTGGG - Intronic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1006147215 6:31966866-31966888 CAGTGTGTGGAGCAGGAGGTTGG + Intronic
1006295470 6:33168260-33168282 GTGTGTGTGCAGGAGCTGGTGGG - Intronic
1006295479 6:33168318-33168340 GTGTGTGTGCAGGAGCTGGTGGG - Intronic
1006295493 6:33168377-33168399 GTGTGTGTGCAGGAGCTGGTGGG - Intronic
1007271062 6:40637441-40637463 ATGTGGGTGCAGAAGGAGTTAGG - Intergenic
1007977409 6:46115385-46115407 CTGGGTCTGCAGAATCTGGTAGG + Intergenic
1008367558 6:50699938-50699960 GTGTGTGTGCATATGGTGGGGGG + Intergenic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1012118087 6:95330297-95330319 GTGTATGTGCCCAAGGTGGTTGG + Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013913170 6:115302878-115302900 GTGTGTGTGAAGAATGTCGTTGG + Intergenic
1015991206 6:138945315-138945337 ATGTGTGTGGAGAAGTTGGTGGG + Exonic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1018150658 6:160934404-160934426 GTGTGTGTGCAGCGTGTGGTGGG - Intergenic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1019010399 6:168839933-168839955 CAGTGTTTCCACAAGGTGGTAGG + Intergenic
1019128687 6:169858574-169858596 CTTTGTGTGTAGGTGGTGGTGGG - Intergenic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1019692419 7:2423727-2423749 CTCAGTGTACAGAGGGTGGTGGG - Intronic
1019823308 7:3262524-3262546 CTGCGTGTGCAGTGGTTGGTGGG + Intergenic
1019944557 7:4316319-4316341 CTGAGTGAGTAGCAGGTGGTGGG - Intergenic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022600139 7:31750155-31750177 TTGTGTGTGGAGAAGGAGATAGG + Intergenic
1022854073 7:34298368-34298390 CTTTGTGGGAAGAAGGTGGGAGG - Intergenic
1023118089 7:36882287-36882309 CTGTGTGTTCAGAACAAGGTCGG + Intronic
1023642361 7:42272852-42272874 CTGTGTCTTAACAAGGTGGTGGG - Intergenic
1024290709 7:47801534-47801556 CTGTGTGTGTAGACTGTGGACGG + Intronic
1024997105 7:55280237-55280259 CTGGGTCTGCAGGAGGGGGTTGG - Intergenic
1025235089 7:57228901-57228923 CTGTGTGTCCAGCAGCTGGCAGG - Intergenic
1026563380 7:71469047-71469069 CGGTGTTGGGAGAAGGTGGTTGG + Intronic
1026832933 7:73621459-73621481 CAGAGAGTTCAGAAGGTGGTGGG - Intronic
1027504831 7:79003184-79003206 GTGTGTATGTAGCAGGTGGTGGG + Intronic
1027720913 7:81740399-81740421 CAGTGTGTACACAAGTTGGTGGG - Intronic
1028400494 7:90420163-90420185 GTGTGGGTCAAGAAGGTGGTAGG - Intronic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029308665 7:99641037-99641059 CAGTCTCTTCAGAAGGTGGTAGG + Intergenic
1029618479 7:101675116-101675138 CTGGATGTGCAGAAGGGGGTCGG - Intergenic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1030713032 7:112775170-112775192 CTGTACCTGCAGAAGTTGGTGGG + Exonic
1031991693 7:128202874-128202896 CTGTCTGTGCAGAGGGTGCCAGG + Intergenic
1032432283 7:131871791-131871813 CTGTCTGTGGAGGAGGTGGTGGG + Intergenic
1032457905 7:132087547-132087569 CTGTGTGTGCTGCTGGAGGTGGG - Intergenic
1032517941 7:132520799-132520821 CTGTGGGGCCAGAAGGTGGGTGG - Intronic
1033038051 7:137893470-137893492 CTTTGTGTGCAGCTGGGGGTGGG + Intronic
1033270733 7:139930664-139930686 CTTTGTGTTCAGAAAGGGGTGGG + Intronic
1034058164 7:148058545-148058567 TTCTGTGTGCAGAGGATGGTAGG - Intronic
1034325066 7:150222256-150222278 CTGTGGATGCAGATGCTGGTTGG + Intergenic
1034748739 7:153548295-153548317 GTGTGTGTGCGGGAGGTGGGTGG + Intergenic
1035214629 7:157355983-157356005 GTGTTTGTGCATATGGTGGTGGG - Intronic
1035425481 7:158769351-158769373 CTGTGTGTGAGAAAGGTGGGTGG - Intronic
1035657460 8:1320699-1320721 GTGGGTGTGCACAAGGTGCTGGG - Intergenic
1036062781 8:5342744-5342766 CTGTGTCTGCAGAATATGGAGGG + Intergenic
1036279771 8:7390878-7390900 CTGTGTGTGTAAATGGAGGTAGG - Intergenic
1036341748 8:7921005-7921027 CTGTGTGTGTAAATGGAGGTAGG + Intergenic
1037124748 8:15334143-15334165 CTGCATGTGCAGAATGTGTTTGG - Intergenic
1038294737 8:26280703-26280725 CTGTGTGTACATAAGGTACTGGG + Intergenic
1038308132 8:26422776-26422798 TTGTGTGTGTAGAGGGGGGTGGG + Intronic
1038542768 8:28402751-28402773 CTGTGTGTGCAGGAGGCAGGAGG - Intronic
1039220735 8:35327519-35327541 CTGTGAGTGCACAAGGTGCCTGG + Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040959356 8:53014789-53014811 GTTTGTGTGCAGGAGGTGGCTGG - Intergenic
1041811905 8:61921183-61921205 ATGTGTGTGCAGGAGGTGTACGG - Intergenic
1043594987 8:81874736-81874758 CTGTGTTTTCAGAAGTTGTTTGG + Intergenic
1043670729 8:82881258-82881280 CTGTGTGTAGATAATGTGGTGGG + Intergenic
1043790481 8:84460988-84461010 CAGTGTTTGCTAAAGGTGGTAGG + Intronic
1044832934 8:96267878-96267900 ATGTGTGGGCAGGAGGTGGCGGG - Intronic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1045455469 8:102374672-102374694 CTATGTGTGCAGAAGGCAGTAGG - Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1045724839 8:105160077-105160099 CTCTGTGTCTGGAAGGTGGTAGG + Intronic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1047410300 8:124619231-124619253 CGGTGTGTACAGAAGCTGGGAGG - Intronic
1048296426 8:133217923-133217945 GTGTGTGTGGAGAAGGGAGTGGG - Intronic
1048369278 8:133763652-133763674 ATGTGAGAGCAGAATGTGGTGGG + Intergenic
1048369284 8:133763704-133763726 ATGTGAGAGCAGAATGTGGTGGG + Intergenic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG + Intergenic
1050288972 9:4133813-4133835 GTGTGTGTGTAGAAGGTCTTGGG - Intronic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1052387451 9:27838395-27838417 ATATGGGTGCAGAAGTTGGTGGG + Intergenic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1055543235 9:77337434-77337456 CAGTGTATTCAGAAGATGGTTGG + Exonic
1056695104 9:88841789-88841811 CTGTGCTTGCAGACTGTGGTGGG + Intergenic
1056761846 9:89421073-89421095 CCGTGTGTGCAGGAGGAGGCTGG - Intronic
1056896818 9:90559082-90559104 CTGTGAGTGAAGAGGGTGGCTGG + Intergenic
1057219573 9:93248731-93248753 CTGTATGTGCAGAAGATACTAGG - Intronic
1057227219 9:93298705-93298727 CTGTGTGCCCTGAAGGTTGTGGG - Intronic
1058058812 9:100474135-100474157 GTGTGTGTGCAGAGTGCGGTGGG + Intronic
1058103666 9:100945568-100945590 TTGCTTGTGCAGAAGGTGATTGG + Intergenic
1058778748 9:108311966-108311988 CTGTGAGTTCAGAAGGGGCTGGG - Intergenic
1059734589 9:117088510-117088532 CTGTGTGTGTTGGAGGTGGGAGG + Intronic
1060896049 9:127218309-127218331 AGGTGTGTGCAGAGGGTGGGTGG - Intronic
1061263529 9:129492805-129492827 CTGTGTGTGCAGTGGAGGGTTGG - Intergenic
1061851446 9:133418253-133418275 CTGTGTGTGTAGCACCTGGTAGG + Intronic
1062126019 9:134863542-134863564 CAGTGTGAGCAGAACGTGGCTGG - Intergenic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186181656 X:6979307-6979329 ATGTGTGTGGAGGAGGTGGTGGG - Intergenic
1186483403 X:9913547-9913569 TTGTGTGTGCAGAGGGTCGATGG + Intronic
1186643638 X:11483168-11483190 GTGTGTGTACAGATGGTTGTTGG - Intronic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189202599 X:39210351-39210373 GTGTGTTTGTGGAAGGTGGTGGG + Intergenic
1189823975 X:44898516-44898538 CTGTGTGTGCAGGAGGGAGGTGG + Intronic
1190157434 X:48005306-48005328 GTGTGTGTGTACAAGGTGGTTGG - Intronic
1190173204 X:48128191-48128213 GTGTGTGTGTACAAGGTGGTTGG - Intergenic
1192174308 X:68876243-68876265 CTGTGTGTGCACATGCTTGTAGG - Intergenic
1192434556 X:71135080-71135102 CTGTGCCTGCAGAAGGAGTTGGG + Exonic
1196547165 X:116975731-116975753 CTGAGGCTGCAGAAAGTGGTGGG - Intergenic
1197341233 X:125268016-125268038 TTGTATGCACAGAAGGTGGTAGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198244819 X:134820064-134820086 CTGTGGCTGCTGAAGATGGTAGG - Intronic
1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG + Intergenic
1199535254 X:148895431-148895453 ATGTGTGTGTTTAAGGTGGTGGG - Intronic
1199769471 X:150965215-150965237 ATGTGTGTGCAGTTGGTGGGTGG + Intergenic
1199806753 X:151307849-151307871 CTTTGGGTGCAGCAGGTGGTGGG + Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1201255653 Y:12105965-12105987 GTATGTGTGCCCAAGGTGGTCGG - Intergenic
1201302052 Y:12516625-12516647 CTGTATGTCCAGGAGTTGGTGGG - Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201987164 Y:19981438-19981460 CTGAGTGTTCAGAGGCTGGTGGG + Intergenic
1202385200 Y:24319428-24319450 GTGTGTGTGCATGTGGTGGTGGG - Intergenic
1202485585 Y:25350700-25350722 GTGTGTGTGCATGTGGTGGTGGG + Intergenic