ID: 1183099231

View in Genome Browser
Species Human (GRCh38)
Location 22:35573737-35573759
Sequence CTGTGTGAACAGAGGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183099221_1183099231 27 Left 1183099221 22:35573687-35573709 CCTCGGGAAACTGGTTCTCTGAG No data
Right 1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG No data
1183099222_1183099231 4 Left 1183099222 22:35573710-35573732 CCTCACTTTCTTCATCTGCAAGG No data
Right 1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183099231 Original CRISPR CTGTGTGAACAGAGGGGGCT GGG Intergenic
No off target data available for this crispr