ID: 1183100119

View in Genome Browser
Species Human (GRCh38)
Location 22:35578742-35578764
Sequence TGCTCACTGCCTCATTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183100119_1183100126 14 Left 1183100119 22:35578742-35578764 CCCCTGGAATGAGGCAGTGAGCA No data
Right 1183100126 22:35578779-35578801 CCCAACATCCAAGGTTGGAATGG No data
1183100119_1183100123 9 Left 1183100119 22:35578742-35578764 CCCCTGGAATGAGGCAGTGAGCA No data
Right 1183100123 22:35578774-35578796 TGTACCCCAACATCCAAGGTTGG No data
1183100119_1183100122 5 Left 1183100119 22:35578742-35578764 CCCCTGGAATGAGGCAGTGAGCA No data
Right 1183100122 22:35578770-35578792 TTACTGTACCCCAACATCCAAGG No data
1183100119_1183100129 24 Left 1183100119 22:35578742-35578764 CCCCTGGAATGAGGCAGTGAGCA No data
Right 1183100129 22:35578789-35578811 AAGGTTGGAATGGAAGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183100119 Original CRISPR TGCTCACTGCCTCATTCCAG GGG (reversed) Intergenic
No off target data available for this crispr