ID: 1183102768

View in Genome Browser
Species Human (GRCh38)
Location 22:35594007-35594029
Sequence GGTCTGAATGCCAGAGTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183102768_1183102775 5 Left 1183102768 22:35594007-35594029 CCCGGAACTCTGGCATTCAGACC No data
Right 1183102775 22:35594035-35594057 ATGCTGAGGCCACTTGGGAATGG No data
1183102768_1183102774 0 Left 1183102768 22:35594007-35594029 CCCGGAACTCTGGCATTCAGACC No data
Right 1183102774 22:35594030-35594052 CTGTGATGCTGAGGCCACTTGGG No data
1183102768_1183102770 -9 Left 1183102768 22:35594007-35594029 CCCGGAACTCTGGCATTCAGACC No data
Right 1183102770 22:35594021-35594043 ATTCAGACCCTGTGATGCTGAGG No data
1183102768_1183102773 -1 Left 1183102768 22:35594007-35594029 CCCGGAACTCTGGCATTCAGACC No data
Right 1183102773 22:35594029-35594051 CCTGTGATGCTGAGGCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183102768 Original CRISPR GGTCTGAATGCCAGAGTTCC GGG (reversed) Intergenic
No off target data available for this crispr