ID: 1183104469

View in Genome Browser
Species Human (GRCh38)
Location 22:35606412-35606434
Sequence CTGTGGGAACCCAGAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183104469_1183104477 15 Left 1183104469 22:35606412-35606434 CCCTCTCCTCTGGGTTCCCACAG No data
Right 1183104477 22:35606450-35606472 ACTCTCTCCTCGTATTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183104469 Original CRISPR CTGTGGGAACCCAGAGGAGA GGG (reversed) Intergenic
No off target data available for this crispr