ID: 1183104625

View in Genome Browser
Species Human (GRCh38)
Location 22:35607182-35607204
Sequence GTGTCTGCTTTGTTTAGTAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183104625_1183104626 -2 Left 1183104625 22:35607182-35607204 CCTCTACTAAACAAAGCAGACAC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1183104626 22:35607203-35607225 ACTCAGAAGCAAACTCTATATGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183104625 Original CRISPR GTGTCTGCTTTGTTTAGTAG AGG (reversed) Exonic
902259059 1:15210389-15210411 GTGTTTTCTTTGTTTTTTAGGGG - Intronic
902956477 1:19927477-19927499 GTGTCTGGTTTTTTTTTTAGAGG + Intergenic
905114585 1:35626585-35626607 GTGTCTTCTTTATTAATTAGTGG - Intronic
906657669 1:47560531-47560553 GTGCCAACTTTGATTAGTAGTGG - Intergenic
907952779 1:59199890-59199912 GTGTCTGCTCAGTGTAGTGGAGG + Intergenic
909251827 1:73367312-73367334 CTGTCTGCTCTGTTGAGTAATGG + Intergenic
913052741 1:115131324-115131346 GTGTCTGGTTTGCTTGGGAGAGG + Intergenic
913555580 1:119963324-119963346 GTGTGTGTTTTGTTAAATAGAGG - Intronic
915387101 1:155504902-155504924 GGGTTTGCTTTGGTAAGTAGGGG - Intronic
916099251 1:161379881-161379903 GGGCCTGCTTTGTTTTGTAGGGG - Intergenic
918517270 1:185376755-185376777 TTATCTGCTTTGTTTATTAACGG + Intergenic
919542145 1:198861687-198861709 GGGTTTGCTTTGTTTAAAAGTGG - Intergenic
919588830 1:199473560-199473582 TTGCCTGCTTTGTTTAGAAATGG + Intergenic
922114569 1:222599983-222600005 ATGTCTCCTTTGTGTAGAAGTGG + Intergenic
922534259 1:226368206-226368228 CTGTCTGCATTGTTCAGGAGCGG + Exonic
923645380 1:235815200-235815222 GTGCCTGGCCTGTTTAGTAGGGG - Intronic
1063969231 10:11369880-11369902 GTTTCTGCTTTCTGTTGTAGGGG - Intergenic
1065219535 10:23482165-23482187 GTGTTTGCTATGATTAGCAGTGG + Intergenic
1071396662 10:85230591-85230613 GTGTCTGATTTCTTGAATAGAGG + Intergenic
1072718831 10:97768615-97768637 GTTTGTGCTATGTTTAGGAGTGG + Intronic
1078459750 11:11505244-11505266 GTGTCTGCTATGATTAGTCATGG + Intronic
1079820213 11:25117364-25117386 ATTTCTGCTTTATTTATTAGGGG + Intergenic
1081172633 11:39887765-39887787 AGGTCTGCTTTATTTTGTAGGGG + Intergenic
1089119629 11:116124599-116124621 GGGTCTGCTTTTTTTTTTAGGGG - Intergenic
1089900140 11:121973608-121973630 GTTTCTGCTTGTTTTAGTTGTGG - Intergenic
1090572828 11:128066997-128067019 GTGTCTGCTTTCTTTAATTTAGG - Intergenic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1095653724 12:44644817-44644839 GTTTCTGCTTTGTTCATCAGTGG - Intronic
1100024462 12:90110952-90110974 GCTTCTGCTTTGTTTAGAGGAGG + Intergenic
1100618675 12:96250785-96250807 CTGTCAGCTTTGCTTAGTGGTGG + Intronic
1101250709 12:102931923-102931945 GTGTCTGCTTCATTTACCAGTGG - Intronic
1104051509 12:125197300-125197322 GTTTTTGTTTTATTTAGTAGAGG + Intronic
1104086971 12:125484325-125484347 ATATCTGCTTCCTTTAGTAGTGG + Intronic
1104428738 12:128699145-128699167 GTGGCTGCTTTGTCCAGTAGTGG + Intronic
1104790770 12:131480718-131480740 GTGTCTGCCTGGATTAGTGGTGG - Intergenic
1105285377 13:18999050-18999072 GTCTCTGCTATGTTTACTACTGG + Intergenic
1106093150 13:26617484-26617506 GTTGCTGCTTTGTTCAGTGGAGG + Intronic
1106758879 13:32848683-32848705 GTATCTGCTTTATTAATTAGAGG - Intergenic
1110025101 13:70527656-70527678 GTGACTGCTCTGGTTTGTAGGGG - Intergenic
1111865594 13:93764209-93764231 GGGTCTGATTTGTTGAGGAGAGG + Intronic
1112079183 13:95949452-95949474 GTGTCTGCGTTCTTTTCTAGTGG - Exonic
1115232170 14:31172594-31172616 GTTTTTTCTTTTTTTAGTAGGGG - Intronic
1115595958 14:34909420-34909442 GTGTGTTTTTTTTTTAGTAGAGG - Intergenic
1119806925 14:77488144-77488166 GTGTCTGCTTTGTTCACTGTGGG + Intronic
1120833307 14:89017164-89017186 GTGGCTGCTTTGTTACATAGAGG + Intergenic
1121240108 14:92423480-92423502 GTATATGCCTTGTCTAGTAGAGG + Intronic
1124209616 15:27752474-27752496 GTGTCTCCTTTCTTCAGAAGTGG + Intergenic
1124407725 15:29406780-29406802 GTGTCTGCTGTGTGTTGGAGGGG - Intronic
1124511465 15:30330374-30330396 GTGTCAGCTTTGTCTAGTTGTGG + Intergenic
1124731449 15:32200383-32200405 GTGTCAGCTTTGTCTAGTTGTGG - Intergenic
1125435681 15:39642733-39642755 TTGTCTGTTTTGCTAAGTAGTGG + Intronic
1129137326 15:73566158-73566180 GTGTCTGGTCTGTTAACTAGGGG - Intronic
1129250440 15:74305901-74305923 GTCTCTTCATTGTTAAGTAGAGG + Intronic
1129992952 15:79980599-79980621 GTTTTTGTTTTGTTTTGTAGAGG + Intergenic
1131217272 15:90548657-90548679 ATGTCAGCTGTGGTTAGTAGTGG - Intronic
1134221070 16:12354507-12354529 GTTTCTGTTTTGTTTTGCAGTGG - Intronic
1140205027 16:72926761-72926783 GTCTCTGCTTTGTGTAGGAGAGG - Intronic
1140736447 16:77902131-77902153 GTGTATGCTTTGTTTTCTAATGG - Intronic
1141367282 16:83455433-83455455 GTCTCTGTTTGGTTTAGAAGTGG + Intronic
1142650871 17:1350888-1350910 GTTTTTTGTTTGTTTAGTAGAGG - Intronic
1147621114 17:41867708-41867730 GAGCCTGCTTTATTTAGCAGGGG - Exonic
1150173427 17:63023541-63023563 ATGTCTGCTTTGTTCAGTTTGGG + Intronic
1150717304 17:67582960-67582982 GTGCCTGCTTTGTTTGGAAGAGG - Intronic
1152775044 17:82195890-82195912 GTGGCAGCTTTGGTTACTAGGGG - Intronic
1153462486 18:5352071-5352093 GTTTTTGCTATGTTTAGTTGAGG + Intergenic
1153647425 18:7207677-7207699 GTGGCTAATTTGCTTAGTAGCGG - Intergenic
1154246752 18:12705912-12705934 GTGTTTGTTTTGTTTATTACAGG + Intronic
1155575652 18:27243252-27243274 ATTCCTCCTTTGTTTAGTAGAGG - Intergenic
1157356930 18:46944028-46944050 TTGTCTGGTTTGTTGTGTAGTGG + Intronic
1157648192 18:49299543-49299565 ATGTCAGGGTTGTTTAGTAGTGG - Intronic
1161452550 19:4354521-4354543 TTGTCTGCTTTGTTTGCTACTGG + Intronic
1164791036 19:30980977-30980999 GAGTCTGTTTTGTTTTGTGGGGG + Intergenic
927566593 2:24118851-24118873 GTGGCTGCTTTTGTTACTAGAGG + Intronic
928062197 2:28125703-28125725 GTGTGTGCATTTGTTAGTAGTGG - Intronic
928871660 2:35987979-35988001 GTGTCTGCTTTACCTAGGAGAGG + Intergenic
931069172 2:58625077-58625099 GTGTTTGCTTTGTATATTAGGGG + Intergenic
936503976 2:113090050-113090072 GTGTCTGCTTTGCTTTCCAGTGG - Intergenic
939119787 2:138102350-138102372 GGGGCTGCTTTGTTGAGAAGGGG + Intergenic
940282633 2:152003538-152003560 GTGTCTCCTTTCTTTTGGAGAGG - Intronic
941672276 2:168307892-168307914 GTTTCTGCTTTGTTTTGTTTTGG - Intergenic
941949456 2:171138760-171138782 GTGTTTGGCTTGTTAAGTAGGGG - Intronic
942241413 2:173965853-173965875 GGGTCTGGTTTGCTCAGTAGCGG - Intergenic
942618675 2:177823787-177823809 GGGTCTGCTTTGTTTTGCTGTGG + Intronic
943199694 2:184804328-184804350 GTCTCTGGTTGGTTTAATAGTGG - Intronic
945100068 2:206255513-206255535 GTTTCTTTTTTCTTTAGTAGTGG + Intergenic
945845871 2:214944039-214944061 GTGTCTGCTTTGTGGAGGAGAGG + Intronic
1168910409 20:1442528-1442550 GTCTCTGGTTTGTTTAATACGGG + Exonic
1169360755 20:4946830-4946852 GTGTATGCTTTGTTTGTTTGGGG + Intronic
1171945199 20:31370350-31370372 GTGTCTGCTTTGAGTGCTAGTGG + Intronic
1172493148 20:35357770-35357792 GTGTTGGCTTTGTTTTGCAGTGG - Intronic
1173364986 20:42376958-42376980 GTGTGTGCTTTCTTTAAAAGGGG - Intronic
1183104625 22:35607182-35607204 GTGTCTGCTTTGTTTAGTAGAGG - Exonic
950086647 3:10263278-10263300 GTGTCTACTTTGCTTAGCATGGG + Intronic
954055827 3:48023874-48023896 GTGCTTGCTATGTTTAGGAGAGG - Intronic
955987995 3:64595114-64595136 TTGTCTCCTTTGTTTGGTATTGG - Intronic
956172212 3:66442084-66442106 GTTTGTGTTTTGTTCAGTAGTGG - Intronic
960423576 3:117478678-117478700 GTGTCTGCACTGTATGGTAGAGG - Intergenic
961060112 3:123821595-123821617 GGGTCTCCTTTGTGTTGTAGGGG + Intronic
961851780 3:129827059-129827081 GTTCCTGCTTTGTTTAACAGAGG - Intronic
964495541 3:157285966-157285988 GTGTCTGATATGTTTAGCACAGG + Intronic
965384646 3:168031532-168031554 GTGTGTGCTTTTGTTAGTTGGGG - Intronic
967479410 3:189956742-189956764 GTGTCTGATTTGTTTAATAAAGG - Exonic
974067459 4:57092606-57092628 GTGTCTGAATTGTTTAGAAGAGG + Intronic
979805376 4:124963840-124963862 GTGTTTGATTTGCTTGGTAGAGG - Intergenic
981260776 4:142716097-142716119 GTGTCTGCTGTGTTAAGCACTGG - Intronic
981733894 4:147928386-147928408 GTCTCTGGTTTGTTTGGGAGTGG + Intronic
983779457 4:171650549-171650571 GTGTCTTCTTTGTGGAGGAGGGG - Intergenic
983934082 4:173487079-173487101 GAGTCTGCTTTAATTAGTATGGG + Intergenic
987561800 5:19533282-19533304 GTTGATGCTTTGTTGAGTAGAGG + Intronic
988169848 5:27639359-27639381 GAGTCTTCTCTGTTTAGTACTGG + Intergenic
988726409 5:33930710-33930732 GTGACTGCTTAGATTAGCAGTGG + Intergenic
988732812 5:33990268-33990290 GTTTCTGTTTTGTTTATTATAGG - Intronic
992793465 5:80234488-80234510 GTGTGTGATGTGTTTAGAAGTGG - Intronic
993088776 5:83397823-83397845 GTGTGTCCTATGATTAGTAGAGG + Intergenic
995356782 5:111246748-111246770 GTCTCTGGTTTGTTTAGGTGTGG - Intronic
995921785 5:117323124-117323146 GGCTCTGCTTTCTTCAGTAGAGG - Intergenic
997985145 5:138495354-138495376 GTGTCTGCCTTGTTGACTACAGG + Intergenic
1004457121 6:15801515-15801537 GTGTCTGCCTTCTTTTATAGCGG + Intergenic
1005225219 6:23634634-23634656 GTGTCTCCTTTGTGTAGTCCAGG - Intergenic
1009777496 6:68223310-68223332 GTTTCTACTTTGCTTATTAGGGG + Intergenic
1010024234 6:71197217-71197239 GTGGCTGACTTGTTTAGAAGAGG + Intergenic
1011643613 6:89436928-89436950 GTGTCTGCATTATTTACTGGTGG + Intronic
1015687548 6:135881986-135882008 GTGTAGTCTTTATTTAGTAGAGG + Intronic
1015989686 6:138925176-138925198 GTGTGTGTATTTTTTAGTAGAGG - Intronic
1016539449 6:145147945-145147967 GTGACTTCTTTTTTTAGAAGGGG - Intergenic
1016774906 6:147894624-147894646 GTTTCTGCTGTGTTTAATATGGG - Intergenic
1019841644 7:3452176-3452198 GTGTCAGCTTTCTTTAGGACAGG + Intronic
1020269083 7:6581537-6581559 GTGTCTGATTTGTTTGGGAGTGG + Intronic
1021216946 7:17927889-17927911 TTGTGTACTTTATTTAGTAGAGG - Intronic
1023673524 7:42605256-42605278 TTTTCTGCTTTGTTAATTAGAGG - Intergenic
1027319392 7:77002630-77002652 GTGTCTGCGGTGTTTACAAGTGG - Intergenic
1027462352 7:78470430-78470452 GTTTCTCCTTTATTTAGTGGTGG + Intronic
1031543865 7:123028733-123028755 GTGTCTGCTTTGACGAGTATTGG - Intergenic
1035892127 8:3356874-3356896 GTGATTGCTCTGATTAGTAGGGG + Intronic
1036450812 8:8865725-8865747 GTGGCTGCCTGGTTTAATAGTGG - Intronic
1038956577 8:32474671-32474693 GTGTGTGTTTTTTTTAGTAGAGG + Intronic
1041239332 8:55835844-55835866 CTGTCTGCTCAGTTTTGTAGGGG + Intergenic
1043148507 8:76683352-76683374 GTGTGTGCTTTTTTTGGAAGGGG - Intronic
1052609592 9:30756395-30756417 ATGTCTGTTTTGATTGGTAGTGG - Intergenic
1053241658 9:36500548-36500570 ATCTTGGCTTTGTTTAGTAGAGG + Intergenic
1053653831 9:40195992-40196014 GTGTATGCTTTATTTTGTTGTGG + Intergenic
1054365953 9:64342212-64342234 GTGTATGCTTTATTTTGTTGTGG + Intergenic
1054673581 9:67831942-67831964 GTGTATGCTTTATTTTGTTGTGG + Intergenic
1056408770 9:86303628-86303650 GTTTCTACTTTGCTTAGTTGTGG + Intronic
1059387587 9:113976800-113976822 TTGTCTGGTGTATTTAGTAGGGG + Intronic
1061001995 9:127907842-127907864 GTGTCTGATGTGTTTAGGGGTGG - Intergenic
1061466008 9:130780318-130780340 GTGTTTGCTTTTTTTTGAAGTGG - Intronic
1186379145 X:9038557-9038579 GTTCCTGATTTGTATAGTAGAGG + Intronic
1189572140 X:42309439-42309461 GTGTCTTCCTTGTTTAGTCTTGG - Intergenic
1190476952 X:50837694-50837716 CTCTCTGCTTAGTTTTGTAGAGG - Intergenic
1195421681 X:104682363-104682385 GTGACTGCTTTGTTAACTAAAGG + Intronic
1197532590 X:127648178-127648200 ATGTCTTCTTTTTTTAGTTGTGG + Intergenic