ID: 1183107206

View in Genome Browser
Species Human (GRCh38)
Location 22:35622936-35622958
Sequence CACCCATGCTGGAGCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 393}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183107206_1183107212 18 Left 1183107206 22:35622936-35622958 CCACTCTGGCTCCAGCATGGGTG 0: 1
1: 0
2: 2
3: 43
4: 393
Right 1183107212 22:35622977-35622999 TGCTTTGGGGTGCACCTGTCTGG 0: 1
1: 0
2: 1
3: 14
4: 118
1183107206_1183107213 23 Left 1183107206 22:35622936-35622958 CCACTCTGGCTCCAGCATGGGTG 0: 1
1: 0
2: 2
3: 43
4: 393
Right 1183107213 22:35622982-35623004 TGGGGTGCACCTGTCTGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 160
1183107206_1183107209 3 Left 1183107206 22:35622936-35622958 CCACTCTGGCTCCAGCATGGGTG 0: 1
1: 0
2: 2
3: 43
4: 393
Right 1183107209 22:35622962-35622984 CCTTCTCATCTCTCTTGCTTTGG 0: 1
1: 0
2: 5
3: 44
4: 311
1183107206_1183107210 4 Left 1183107206 22:35622936-35622958 CCACTCTGGCTCCAGCATGGGTG 0: 1
1: 0
2: 2
3: 43
4: 393
Right 1183107210 22:35622963-35622985 CTTCTCATCTCTCTTGCTTTGGG 0: 1
1: 0
2: 5
3: 48
4: 445
1183107206_1183107211 5 Left 1183107206 22:35622936-35622958 CCACTCTGGCTCCAGCATGGGTG 0: 1
1: 0
2: 2
3: 43
4: 393
Right 1183107211 22:35622964-35622986 TTCTCATCTCTCTTGCTTTGGGG 0: 1
1: 0
2: 1
3: 44
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183107206 Original CRISPR CACCCATGCTGGAGCCAGAG TGG (reversed) Intronic
900854848 1:5172608-5172630 CTCCCAGTCTGGAGCCACAGGGG - Intergenic
901305256 1:8228140-8228162 CACACATGCTGGGGTCACAGTGG + Intergenic
901496874 1:9627311-9627333 CACCCCTGCAGGAGGCAAAGAGG - Intergenic
902087267 1:13873201-13873223 CTCCCCCACTGGAGCCAGAGAGG - Intergenic
902329973 1:15726523-15726545 CAGCCAACCTGGAACCAGAGTGG + Intronic
902579032 1:17396821-17396843 CCCTCATGCTGGGGACAGAGTGG + Intronic
903369629 1:22826846-22826868 CAGCAATGCTGGAGCCAGTCTGG + Intronic
904008258 1:27374920-27374942 CACCCAGACTGGAGCCAGCAGGG + Intergenic
904753581 1:32755538-32755560 AACCCCTGTAGGAGCCAGAGTGG - Intronic
905022203 1:34825662-34825684 GGCCCAGCCTGGAGCCAGAGAGG + Intronic
908877927 1:68698918-68698940 CAGCTATGCTGGAGGCTGAGGGG + Intergenic
909697514 1:78484157-78484179 TTCCCCTGCTGGAGCCAGTGAGG + Intronic
911574781 1:99562519-99562541 CACCCAGGCTGGAGTTACAGTGG + Intergenic
911879978 1:103224810-103224832 AGCCCCTGCTGGAGCCAGAGTGG - Intergenic
913326910 1:117635414-117635436 CATCCATGCTGCAGGCAAAGAGG - Intergenic
913541181 1:119822457-119822479 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
915011345 1:152689015-152689037 CACCCATGTGGGAGACAGTGTGG - Intergenic
915070146 1:153259971-153259993 CCCCTATGCGGGTGCCAGAGAGG - Intronic
915206646 1:154274973-154274995 CCCCCATCCTAGAACCAGAGAGG + Exonic
915636380 1:157189888-157189910 CATCCAGGCTGGAGCCAGGGAGG + Intergenic
916849032 1:168684031-168684053 TTCCCCTGCTGGAGCCAGGGTGG - Intergenic
917024886 1:170631195-170631217 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
917060579 1:171033116-171033138 TTCCCCTGCTGGAGCCAGGGAGG - Intronic
917079054 1:171237649-171237671 GTCCCCTGCTGGAGCCAGGGAGG + Intergenic
917582386 1:176391923-176391945 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
917880809 1:179333955-179333977 CAACCATGGCGGAGCCAGAGGGG + Intronic
918076543 1:181175387-181175409 CACCCAGGCTGGAGCGGCAGAGG + Intergenic
918362365 1:183772078-183772100 CACCGATGGGGGAGCCAGAAGGG - Intronic
918802271 1:188986828-188986850 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
918943158 1:191027170-191027192 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
919586639 1:199447972-199447994 TTCCCCTGCTGGAGCCAGGGGGG - Intergenic
919822596 1:201482399-201482421 CCCCTGTGCTGGAGCCAGAGGGG + Intergenic
920394517 1:205634444-205634466 CACCCATGCTAGAGTTACAGTGG + Intergenic
922375978 1:224966724-224966746 CACCCAGGCTGAAGCCACAATGG + Intronic
922740960 1:228014011-228014033 CAGCTGTGCTGGAGCCAGAGGGG + Intronic
922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG + Intergenic
923105940 1:230853920-230853942 CACAGCTGCTGGGGCCAGAGTGG - Intronic
923553899 1:234985728-234985750 CACCCAGGTGGGAGACAGAGTGG - Intergenic
924459398 1:244244911-244244933 CACCCATGCTGGGACCAAGGCGG + Intergenic
1062905404 10:1176224-1176246 CTCCAATGCTGCAGCCGGAGGGG - Intergenic
1064428844 10:15254262-15254284 CACCTATGCTGCAGCCAGGAGGG - Intronic
1066275247 10:33862420-33862442 CGGTCATGCTGGAGCCAGCGTGG + Intergenic
1070038109 10:72747721-72747743 CAGCTATTCTGGAGGCAGAGTGG + Intronic
1071044817 10:81361140-81361162 CTACCAGGCTGGAGCCACAGAGG + Intergenic
1071059047 10:81548421-81548443 TTCCCCTGCTGGAGCCAGAGAGG + Intergenic
1072698267 10:97620446-97620468 CACCCAGGCTGGAGTAACAGTGG - Intronic
1074003336 10:109393766-109393788 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1075172390 10:120127825-120127847 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1075673584 10:124281020-124281042 CGCCCAGCCTGGAGCCACAGAGG - Intergenic
1076002207 10:126921379-126921401 CACCCATGCTGTAGCATGATCGG - Intronic
1076821034 10:132939693-132939715 CACGCCTGCTTGAGTCAGAGGGG + Intronic
1078269473 11:9781542-9781564 CTCCCATGCTGGGGCCAGCAGGG + Exonic
1079800265 11:24860096-24860118 TTCCCCTGCTGGAGCCAGGGAGG + Intronic
1079935271 11:26608788-26608810 TTCCCGTGCTGGAGCCAGGGAGG - Intronic
1080741857 11:35072616-35072638 CACCCAGGCTGGAGTCGCAGTGG - Intergenic
1081063043 11:38504046-38504068 AACCCCTGCTGGATCCAGAGGGG - Intergenic
1081454953 11:43212400-43212422 TTCCCCTTCTGGAGCCAGAGAGG - Intergenic
1081753867 11:45531099-45531121 CACCCAGGCTGGAGTGAGAGAGG + Intergenic
1081865355 11:46356666-46356688 CATCCAGGGTGGAGCCTGAGGGG + Intronic
1081912180 11:46706760-46706782 CACGCATGCTGGGGGCAGGGAGG + Intergenic
1082282797 11:50288219-50288241 CATCCATACTGAAGTCAGAGTGG + Intergenic
1083826287 11:65205756-65205778 CACCCCTGATGGTGCCAGAGGGG + Intronic
1083901160 11:65644222-65644244 CATCCTTGCTGCAGCCAGGGAGG + Intronic
1084046411 11:66570730-66570752 CATTAGTGCTGGAGCCAGAGTGG + Intergenic
1084461817 11:69300429-69300451 CCACCATCCTGGAGACAGAGAGG + Intronic
1085049556 11:73373200-73373222 CTCCCATGAGGGAGCCAGTGAGG + Intergenic
1085145068 11:74188225-74188247 CACCCAGGCTGGAGTGAAAGTGG + Intronic
1086146851 11:83561338-83561360 CACCCATCCAGGACTCAGAGGGG + Intronic
1088084466 11:105960480-105960502 TTCCCCTGCTGGAGCCAGGGAGG - Intronic
1088115457 11:106306883-106306905 CAGCCAAGTTGGACCCAGAGAGG - Intergenic
1088697706 11:112382685-112382707 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1088810366 11:113387827-113387849 CACCCAGGCAGCAGCCACAGCGG + Exonic
1089453526 11:118612589-118612611 CACCCAAGCTGGCGGAAGAGAGG - Intronic
1090739057 11:129640691-129640713 CCTTCATGCTGGAGCCAGACAGG + Intergenic
1091447326 12:551466-551488 AACCCATGCGGAAGCCAGACAGG + Intronic
1091664163 12:2407073-2407095 CACCCTGGCTGGAGGCAGAGGGG + Intronic
1091775096 12:3179284-3179306 CACCCCACCTGGAGTCAGAGTGG - Intronic
1091793758 12:3285958-3285980 GGCCCATGCTGGAGGGAGAGGGG - Exonic
1093522484 12:20067055-20067077 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1093659187 12:21734976-21734998 CAACCATGGTGGAGACAGTGTGG + Intronic
1094164405 12:27427635-27427657 CAGACAGCCTGGAGCCAGAGAGG + Intergenic
1094713162 12:32985755-32985777 CACCGCTGCTGGGGCCTGAGTGG + Intergenic
1096581142 12:52586137-52586159 CACCAATGCTGGGGCAGGAGGGG - Exonic
1097748940 12:63330896-63330918 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1100028106 12:90153466-90153488 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1100672046 12:96824128-96824150 CACGCATGCTGCAGCTAGCGAGG - Intronic
1101066527 12:101027513-101027535 TTCCCCTGCTGGAGCCAGGGAGG + Intronic
1101241372 12:102842945-102842967 CACCCAAGCAGGAGACAGACTGG - Intronic
1102819861 12:115898872-115898894 GCCACATGATGGAGCCAGAGAGG + Intergenic
1102855722 12:116291667-116291689 CACCCAGGCTGGAGTCAGTGGGG + Intergenic
1103258045 12:119560130-119560152 CTCCCAAGCTTGAGCCAGGGAGG + Intergenic
1104670766 12:130678431-130678453 CACCCACGCTGTACCCTGAGCGG - Intronic
1105505717 13:21008080-21008102 TCCCCACGGTGGAGCCAGAGTGG - Intronic
1105603686 13:21909690-21909712 CACCCACACTGCAGCCAGCGTGG - Intergenic
1105766753 13:23567383-23567405 CACGGATGCTGGAGTCAGAAAGG - Intergenic
1107362682 13:39637253-39637275 CACCCAGGCTGGAGCTGCAGTGG + Intergenic
1108815660 13:54287156-54287178 TTCCCTTGCTGGAGCCAGGGAGG - Intergenic
1108957772 13:56182690-56182712 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1112067863 13:95813865-95813887 AGCCGATGCTGGAGCCAGAGTGG - Intronic
1112379334 13:98873628-98873650 CATCCATGCTGGAGCCAGTAGGG - Intronic
1112850123 13:103696108-103696130 GACGCATGCTGGAGTCAGTGGGG + Intergenic
1113994696 14:16056492-16056514 CACCCATGCATGCGCCACAGGGG - Intergenic
1114705955 14:24726820-24726842 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1114764106 14:25350783-25350805 CATCCATTCAGGTGCCAGAGTGG + Intergenic
1117026117 14:51621861-51621883 CACACAAGCTGGGGCCAGATGGG - Intronic
1117192498 14:53306620-53306642 AACCCAAGCTGGAGGCAGCGAGG - Intergenic
1118301397 14:64619598-64619620 CACCCTTTCTGGATCCAAAGAGG - Intergenic
1118530666 14:66701946-66701968 CTCCCCTCCTGGAGCCAGGGAGG + Intronic
1118786920 14:69053988-69054010 CCCCAATGCTGGAACAAGAGAGG - Exonic
1118834642 14:69468610-69468632 CACCCATGCTGGAGGGGCAGTGG + Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1121740189 14:96246417-96246439 CCAGCTTGCTGGAGCCAGAGAGG - Intronic
1121905711 14:97741108-97741130 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1123049561 14:105534477-105534499 CACCCATGTTTCAGCCAGGGTGG - Intergenic
1123754793 15:23388811-23388833 CACCCAGGCTGGAAGCACAGTGG - Intergenic
1124206257 15:27723596-27723618 CACCCAGGGAGGAGCAAGAGGGG + Intergenic
1126553010 15:49953550-49953572 TTCCCCTGCTGGAGCCAGGGAGG - Intronic
1126678608 15:51183160-51183182 CACTTATTCTGGAGCCAGACAGG - Intergenic
1126825565 15:52544517-52544539 CACCCAGGCTGGAGGTACAGTGG + Intergenic
1127687723 15:61364958-61364980 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1127863228 15:63011706-63011728 CACCTATGCCTGATCCAGAGAGG - Intergenic
1129160244 15:73743343-73743365 CCCCCAGGTTGGAACCAGAGAGG - Intronic
1129773327 15:78216732-78216754 CACCCAGGCAGGAGCCAAGGTGG - Intronic
1130879899 15:88046070-88046092 CACCCAGGCTGGAGCATCAGTGG + Intronic
1131228928 15:90646533-90646555 AAGCCTTACTGGAGCCAGAGAGG - Intergenic
1131835003 15:96381547-96381569 CACCCACGCCAGAGCCAGAATGG - Intergenic
1133507966 16:6430772-6430794 CATCCACACTGCAGCCAGAGTGG - Intronic
1134461576 16:14434169-14434191 CACCCAGGCTGGAAGCACAGTGG + Intergenic
1134684995 16:16152334-16152356 CAGCCATGCTGGGGCCCCAGGGG - Intronic
1135964015 16:27021137-27021159 CCTCCATGCAGCAGCCAGAGTGG + Intergenic
1137249398 16:46731203-46731225 AGCCCGTGATGGAGCCAGAGGGG + Intronic
1137343767 16:47636348-47636370 CACACTTCATGGAGCCAGAGGGG + Intronic
1137394953 16:48110486-48110508 GCCCCATGCTGGACACAGAGAGG - Intronic
1137677923 16:50313072-50313094 CACCCATGCTGGAGAGGGAAGGG + Intronic
1137706373 16:50538645-50538667 AAATCATGCTGGAGGCAGAGAGG + Intergenic
1138100280 16:54246691-54246713 ACCCCAGGCTGGAGGCAGAGTGG + Intronic
1140146586 16:72316839-72316861 CACCCATGCCTGAGCCTGAAGGG - Intergenic
1141581798 16:85004424-85004446 CCCCCATGCAGCACCCAGAGTGG + Intronic
1141956581 16:87375939-87375961 CCCACATGCAGGGGCCAGAGAGG + Intronic
1143181493 17:4986962-4986984 GGCTCAGGCTGGAGCCAGAGCGG - Exonic
1143181780 17:4987935-4987957 CACCAGTGCTGGAACCCGAGGGG + Intergenic
1147014978 17:37484569-37484591 CACCCAGGCTGGAGTTGGAGTGG + Intergenic
1147219634 17:38920728-38920750 CACCTAGGCTGGGGCCAGAAAGG - Exonic
1149910020 17:60558525-60558547 CAGCCATGCTGAAGTCTGAGGGG + Intergenic
1151410309 17:73921405-73921427 CCCCAAAGCTGGAGGCAGAGTGG + Intergenic
1152552488 17:81036515-81036537 CACTCCAGCTGGAACCAGAGGGG - Intronic
1152693979 17:81734685-81734707 ACCCCACGCTGGAGACAGAGGGG + Intergenic
1152915320 17:83031691-83031713 CACACCTGCTGCAGTCAGAGTGG - Intronic
1154411716 18:14145374-14145396 CAGCCATGCTGGAGGCCTAGAGG - Intergenic
1155847784 18:30731228-30731250 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1155898215 18:31355130-31355152 CACCCATGCTGGTGCCAACCAGG - Exonic
1156668707 18:39440478-39440500 CACCCAGGCTGGAGTTACAGTGG - Intergenic
1156766494 18:40662966-40662988 CATCAATGGTGGAGCCAGAAAGG + Intergenic
1157034330 18:43953125-43953147 AGCCAAGGCTGGAGCCAGAGTGG - Intergenic
1157321776 18:46640159-46640181 TATCCGTGCTTGAGCCAGAGTGG - Intronic
1157593186 18:48848352-48848374 CAGCCATGAGGGAGCCAAAGTGG - Intronic
1157700650 18:49759864-49759886 CACTCTTCCTGCAGCCAGAGTGG - Intergenic
1158105661 18:53882637-53882659 TTACCATGCTGGAGCCAGGGAGG - Intergenic
1159030463 18:63225657-63225679 CACCCCTGCCAGTGCCAGAGTGG - Intronic
1161357102 19:3825287-3825309 CACACACGCTGGGGCCAGTGGGG + Exonic
1161845021 19:6707386-6707408 CGGCCGTGCAGGAGCCAGAGAGG - Intronic
1162141056 19:8585822-8585844 CACCCAGACTGGGGGCAGAGAGG + Intronic
1162753188 19:12841154-12841176 CACCCGAGCTGGGGCCTGAGGGG + Intronic
1164754757 19:30681354-30681376 CACTCCTGCTGGAGCCAGTGTGG + Intronic
1164934000 19:32197190-32197212 CACCCTACCTGGGGCCAGAGGGG - Intergenic
1165210447 19:34231554-34231576 CAGCCATGCTGTGGACAGAGGGG - Intergenic
1165538274 19:36468663-36468685 CAGCCCTTCTGGAGCCTGAGTGG + Intronic
1165830382 19:38727689-38727711 CACCCCTGCTGTGGGCAGAGAGG + Intronic
1165940477 19:39412705-39412727 CACCCAGCCGGGAGCCCGAGGGG + Exonic
1165961250 19:39536499-39536521 CACCCATGCTGGAGCTTGCTGGG + Intergenic
1167419357 19:49394152-49394174 CTCCCAGGCTGGACTCAGAGAGG - Intronic
927678075 2:25121549-25121571 CACGCATCCTGGAGCCAGCTTGG - Intronic
927847957 2:26480978-26481000 CACCCAGGCTGGGCCCAGTGTGG + Exonic
928757590 2:34545511-34545533 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
929075294 2:38075382-38075404 TGCCCATGCTGGGGACAGAGAGG + Exonic
929410134 2:41689779-41689801 CTCCCTTGCTGCAGGCAGAGAGG + Intergenic
930545759 2:52765799-52765821 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
931273780 2:60726191-60726213 CACCCAGGCTGGAGTGTGAGTGG - Intergenic
931378114 2:61726358-61726380 AACCCATGGAGGAGACAGAGAGG + Intergenic
931949117 2:67341519-67341541 CTCCCATGCTTGGGACAGAGGGG - Intergenic
932013456 2:68000754-68000776 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
932826721 2:74948009-74948031 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
933237597 2:79882552-79882574 TTCCCCTGCTGGAGCCAGGGAGG - Intronic
934750192 2:96789056-96789078 CACCCCTGCTGGATACAGAAAGG - Intronic
936675504 2:114709315-114709337 CACCTAGGCTGGAGAGAGAGAGG - Intronic
936849099 2:116874055-116874077 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
937893978 2:126963457-126963479 TTCCCCTGCTGGAGCCAGGGGGG - Intergenic
937931493 2:127208657-127208679 TTCCCCTGCTGGAGCCAGGGAGG + Intronic
938790473 2:134671440-134671462 GAGCCAGGCTGGAGACAGAGTGG - Intronic
939211687 2:139183638-139183660 CACCCAGCCTGGTGACAGAGTGG - Intergenic
940151150 2:150602394-150602416 CACCCAGGCTGGAGTCCGGGGGG + Intergenic
940410717 2:153360521-153360543 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
940482445 2:154252394-154252416 CACCCAGGCTGGAGTTACAGTGG + Intronic
941694387 2:168535057-168535079 TTCCCCTGCTGGAGCCAGGGAGG - Intronic
942376108 2:175339643-175339665 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
943216534 2:185044402-185044424 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
944180736 2:196889972-196889994 CACCCAGGCTGGAGCGCTAGTGG + Intronic
947480106 2:230491507-230491529 CTCCTCTGCTGGAGCCAGGGAGG - Intronic
948575899 2:238949461-238949483 CAGCCAGGCTGGATGCAGAGTGG - Intergenic
948806941 2:240457072-240457094 TGCCCATGCTGCAGACAGAGCGG - Intronic
1168933543 20:1644404-1644426 TTCCCCTGCTGGAGCCAGGGAGG - Intronic
1169893481 20:10477936-10477958 CGCCCATGCTGGAGTGGGAGTGG + Intronic
1169980587 20:11379816-11379838 TTCCCCTGCTGGAGCCAGAGAGG + Intergenic
1170496589 20:16930939-16930961 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1170561689 20:17563844-17563866 CACCCAGGCTGGAGTTACAGTGG - Intronic
1171048406 20:21832930-21832952 CACACTTGCATGAGCCAGAGCGG + Intergenic
1171107953 20:22453692-22453714 CATCAATACTGCAGCCAGAGGGG - Intergenic
1171202249 20:23251389-23251411 AACCCATGATGGACCCACAGAGG - Intergenic
1173091329 20:39974968-39974990 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1173239187 20:41278301-41278323 CACCCAGGCTGGAGTTACAGTGG - Intronic
1173932359 20:46831344-46831366 CTCCAGTGCTGGGGCCAGAGAGG - Intergenic
1174481978 20:50837701-50837723 CAGCCAAGCCGCAGCCAGAGAGG - Intronic
1175820177 20:61904785-61904807 CACCTATGCTGGGGCCACGGTGG - Intronic
1176109762 20:63405930-63405952 GAACCAAACTGGAGCCAGAGTGG - Intergenic
1176326684 21:5507774-5507796 CACTCTTGCTGGAGCACGAGAGG + Intergenic
1176401073 21:6313177-6313199 CACTCTTGCTGGAGCACGAGAGG - Intergenic
1176436084 21:6675927-6675949 CACTCTTGCTGGAGCACGAGAGG + Intergenic
1176460346 21:7002997-7003019 CACTCTTGCTGGAGCACGAGAGG + Intergenic
1176483907 21:7384775-7384797 CACTCTTGCTGGAGCACGAGAGG + Intergenic
1176861322 21:14012964-14012986 CAGCCATGCTGGAGGCCTAGGGG + Intergenic
1177511391 21:22091880-22091902 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1177532117 21:22373985-22374007 TAGCCATGCTGGAGCCAGAGTGG + Intergenic
1177956600 21:27606239-27606261 TGCCCATGCTGGAGCCAGGGAGG - Intergenic
1179109224 21:38431889-38431911 CTCACATGCTGCAGCCACAGAGG + Intronic
1179349056 21:40590325-40590347 AACCCATGCTTGGGCCAGAGGGG + Intronic
1179430145 21:41316227-41316249 GACCCATGCCGTGGCCAGAGGGG + Intronic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1179799536 21:43804496-43804518 CACACCTGCTGGAGCCTGTGAGG + Exonic
1179996240 21:44975734-44975756 CTGCCATGCTGGGGCCAGGGTGG + Intronic
1180183369 21:46127742-46127764 CACTCACACTGGACCCAGAGTGG - Intronic
1180222736 21:46369796-46369818 GACGCCTGCTGGAGGCAGAGAGG + Intronic
1180259956 21:46662152-46662174 CGCCCAGGCTGGGCCCAGAGTGG - Intronic
1180312396 22:11250917-11250939 CACCCATGCATGCGCCACAGGGG + Intergenic
1180873626 22:19163039-19163061 CACCCAGGCTGGAGTGAAAGTGG + Intergenic
1180933122 22:19606841-19606863 CACCCATGCTGAAGAGATAGAGG - Intergenic
1181538161 22:23557534-23557556 CACCTCTGCTGGAGGCAGACAGG - Intergenic
1182907867 22:33954050-33954072 CATGGATGTTGGAGCCAGAGAGG + Intergenic
1183107206 22:35622936-35622958 CACCCATGCTGGAGCCAGAGTGG - Intronic
1183134361 22:35872537-35872559 CACCAATGTGGGAGCCAGAAGGG + Intronic
1183202391 22:36394594-36394616 CACCCAGGCTGGAGCTGCAGTGG + Intergenic
1183482564 22:38073159-38073181 CAGCCATGCTGCGGCCAGCGAGG + Intronic
1184335970 22:43853457-43853479 GACCCCTGCTGGATGCAGAGCGG + Intronic
1184513438 22:44946123-44946145 GAGGCCTGCTGGAGCCAGAGTGG + Intronic
1184552547 22:45212262-45212284 CACCCATGGAGCATCCAGAGAGG + Exonic
1185008482 22:48299692-48299714 CACACATCGTGGGGCCAGAGGGG - Intergenic
1185106750 22:48875236-48875258 CACCCCTGCTAGAAGCAGAGGGG - Intergenic
1185229460 22:49671858-49671880 CAGCCCCGCTGGAGCCAGGGCGG + Intergenic
949119957 3:373462-373484 CTCCCCTGCTGGAGCCAGGGAGG - Intronic
949693502 3:6667616-6667638 AAGCTAGGCTGGAGCCAGAGAGG - Intergenic
951688413 3:25370574-25370596 AAGCCATGCTGGAGTCAGAAGGG - Intronic
953559144 3:43971436-43971458 CACCTAGGCTGGGGCCAGAAGGG + Intergenic
953582679 3:44171597-44171619 CGCCCATGTTGGAGGAAGAGTGG - Intergenic
954809809 3:53240942-53240964 AACCCAAGCTGGTGCCAAAGGGG - Intronic
954990555 3:54837286-54837308 CACCAGAGCTGGAGTCAGAGGGG - Intronic
955224642 3:57050620-57050642 CAGACAGGCTGGGGCCAGAGTGG + Intronic
955832137 3:63015704-63015726 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
956275389 3:67494877-67494899 CACCCATGCTAGGGGCAGTGTGG - Intronic
957268874 3:78003277-78003299 TTCCCTTGCTGGAGCCAGGGAGG - Intergenic
957291330 3:78281583-78281605 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
957630097 3:82707241-82707263 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
958569944 3:95865943-95865965 CAACCATTCTGGAGTCAGTGTGG + Intergenic
959031105 3:101300242-101300264 TTCCCCTGCTGGAGCCAGGGAGG - Intronic
960233431 3:115254926-115254948 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
960413723 3:117359026-117359048 TTCCCCTGCTGGAGCCAGAGGGG + Intergenic
961041542 3:123681994-123682016 CACCCAGGCTGGAGACAGGCTGG + Intronic
963461259 3:145617326-145617348 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
964831203 3:160886009-160886031 TTCCCCTGCTGGAGCCAGTGAGG + Intronic
965469047 3:169067184-169067206 CAGCCACGCTAGAGCCAGGGAGG + Intergenic
966250521 3:177860288-177860310 TTCCCTTGCTGGAGCCAGGGAGG - Intergenic
966430966 3:179831277-179831299 CACCCAGGCTGGAGTTGGAGTGG - Intronic
966539645 3:181075201-181075223 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
967169710 3:186813470-186813492 CACATATCCTGCAGCCAGAGGGG + Intergenic
968231306 3:197006364-197006386 CAACGATGCAGGAGGCAGAGGGG + Intronic
969449855 4:7266797-7266819 CAGCAATGCTGGAGCCACTGAGG - Intronic
970155089 4:13133630-13133652 TTTCCCTGCTGGAGCCAGAGAGG + Intergenic
970494284 4:16609506-16609528 TTCCCCTGCTGGAGCCAGGGAGG + Intronic
970952752 4:21775794-21775816 TTCCCCTGCTGGAGCCAGGGAGG - Intronic
971005546 4:22370395-22370417 CACCCCTGCTGGTGCCAAAGTGG + Intronic
971853159 4:32010343-32010365 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
972284341 4:37633988-37634010 CACACATGCTGGAGTGAGACCGG - Intronic
974885216 4:67809672-67809694 TACCCCTGCTGGAGCCAGGGCGG + Intergenic
975608849 4:76183787-76183809 CTCCCATCCAGGAGCCATAGAGG + Intronic
975821918 4:78279407-78279429 CACCCATGCAGCAGCCAAAGTGG - Intronic
976538224 4:86242687-86242709 CTCCCCTGCTAGAGCCAGGGAGG - Intronic
976886200 4:89987486-89987508 AACCCAGATTGGAGCCAGAGAGG - Intergenic
979775423 4:124583365-124583387 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
979978357 4:127224649-127224671 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
980184639 4:129446393-129446415 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
980853424 4:138411145-138411167 CACCGACGCTGGAGTCAGAATGG + Intergenic
981237536 4:142436058-142436080 TACCCCTGCTGAAGCCAGGGAGG + Intronic
984092098 4:175387380-175387402 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
984334996 4:178379257-178379279 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
984626125 4:182009567-182009589 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
986094621 5:4542377-4542399 CACCCAGGCTAAAGCCATAGAGG + Intergenic
986345406 5:6830229-6830251 CAGGCACGCTAGAGCCAGAGAGG + Intergenic
986385186 5:7226384-7226406 CACCCAGGCTGAAGCTGGAGGGG - Intergenic
986588770 5:9346673-9346695 CACCCCTGCTAGTGCCAAAGTGG + Intronic
986674195 5:10168999-10169021 CAGCCATGCTGGAGCATGAGGGG - Intergenic
987029676 5:13964293-13964315 CAACCGTGGAGGAGCCAGAGGGG - Intergenic
988596442 5:32596301-32596323 CACTCAAGTTGGAGCCACAGGGG - Intronic
989396572 5:40963513-40963535 CTTCCATGATAGAGCCAGAGTGG + Intronic
990342124 5:54833839-54833861 CACTCAAGTTAGAGCCAGAGAGG + Intergenic
990408185 5:55513298-55513320 CACCCATGCTGGAGGTACAGTGG + Intronic
990533908 5:56701143-56701165 CACCCATTCTGTAGCCCAAGTGG + Intergenic
990981616 5:61607110-61607132 CACCTCTGAGGGAGCCAGAGAGG + Intergenic
991590047 5:68241708-68241730 CACCCATCCTGAAGTGAGAGAGG - Intronic
994732378 5:103507871-103507893 CACCCACCATGGTGCCAGAGGGG + Intergenic
995080657 5:108047595-108047617 TTCCCTTGCTGGAGCCAGGGAGG + Intronic
996893820 5:128456099-128456121 TTCCCCTGCTGGAGCCAGGGAGG + Intronic
998069356 5:139184631-139184653 CACCCAGGCTGGAGTAACAGTGG - Intronic
998128912 5:139641338-139641360 CTCCCAGGCTGCAGCAAGAGCGG + Intergenic
998220446 5:140273819-140273841 TAACCATGTTGGAGACAGAGGGG + Intronic
999596885 5:153214837-153214859 TTCACCTGCTGGAGCCAGAGAGG + Intergenic
999657503 5:153825161-153825183 GACTCATGCTGCTGCCAGAGAGG - Intergenic
1001139683 5:169134331-169134353 CTCACATGCTGCAGCCAGACTGG + Intronic
1002378767 5:178809266-178809288 CTCCCATGCTGCAGCCTCAGTGG - Intergenic
1002935388 6:1667355-1667377 AACCCATGCTGAAACCTGAGTGG + Intronic
1003259804 6:4506835-4506857 AGCCCTGGCTGGAGCCAGAGTGG + Intergenic
1003629914 6:7777471-7777493 TCCCCATACTGGAGCCAGAGGGG - Intronic
1004237598 6:13888262-13888284 CATCCATTCTGGAGCCAGACAGG + Intergenic
1004560422 6:16744289-16744311 CATCCATGTAGGAACCAGAGAGG - Intronic
1004753625 6:18588172-18588194 TGACTATGCTGGAGCCAGAGAGG + Intergenic
1004753741 6:18589253-18589275 TGACTATGCTGGAGCCAGAGAGG - Intergenic
1007826945 6:44607702-44607724 GAGACATGCTGGAGCCAAAGAGG + Intergenic
1008741556 6:54615072-54615094 TCCCAATGCTGGAGCCAGGGAGG + Intergenic
1009431909 6:63573580-63573602 CACCCCTGCCCGGGCCAGAGTGG + Intronic
1010483225 6:76379309-76379331 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1013461505 6:110378878-110378900 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1014406773 6:121062551-121062573 CACACAGGATGGAGGCAGAGAGG - Intergenic
1014864003 6:126505857-126505879 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1015358179 6:132305168-132305190 TTCCCCTGCTGGAGCCAGAGAGG + Intronic
1015632774 6:135247994-135248016 AAACCCTGCTGGATCCAGAGGGG - Intergenic
1015660195 6:135566416-135566438 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1016414801 6:143821022-143821044 CGCCAAGGCTGGAGCCAAAGTGG + Intronic
1017609358 6:156168055-156168077 CACCCAGGCTGGAGGGAGGGAGG + Intergenic
1018436570 6:163764784-163764806 CACCCTTCCTGCAGCCAGTGAGG - Intergenic
1019069021 6:169326195-169326217 CACCCATGCCGGACCCAACGTGG + Intergenic
1019551517 7:1605256-1605278 CATCCATGCTGCAGCCTGTGTGG - Intergenic
1020117501 7:5484143-5484165 CTCACGAGCTGGAGCCAGAGGGG - Intronic
1020177553 7:5895176-5895198 GAGCCATGCTGGACCCAGAGGGG + Intergenic
1020305363 7:6829770-6829792 AAACCATGCTTGACCCAGAGGGG - Intergenic
1020525247 7:9251120-9251142 TTCCCCTGCTGGAGCCAGAGAGG + Intergenic
1022226952 7:28372987-28373009 GAGCCAGGCAGGAGCCAGAGCGG - Intronic
1023006760 7:35878550-35878572 CATCCATACTGAAGTCAGAGTGG - Intronic
1023959565 7:44914939-44914961 CACCCAGGCTGGAAGCACAGTGG - Intergenic
1024099483 7:46015704-46015726 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1026307480 7:69154579-69154601 CACACAGGCTGGGGCCACAGCGG - Intergenic
1027181715 7:75945258-75945280 CACCCAGGCTGGAGGCATAGTGG - Intronic
1027586703 7:80066747-80066769 AACCAAGGCTGGAGCCAGAGTGG + Intergenic
1027976994 7:85171392-85171414 CAACCATGATGGAGCTAGAAAGG + Intronic
1028517970 7:91698870-91698892 TTCCCCTGCTGGAGCCAGGGAGG + Intronic
1028644133 7:93076661-93076683 TACCCTGGCTGGAGCCAGGGAGG + Intergenic
1028921698 7:96316898-96316920 CACAGCTGCTGGAGCCAGACTGG + Intronic
1029081287 7:97975825-97975847 GAGCCATGCTGGACCCAGAGGGG - Intergenic
1030701581 7:112646937-112646959 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1031804571 7:126292652-126292674 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1032726304 7:134592680-134592702 ACCCCCTGCTGGACCCAGAGAGG - Intergenic
1033154125 7:138942404-138942426 CTCGGATGCTGAAGCCAGAGAGG + Intronic
1033318509 7:140318254-140318276 CACCCATGCAGCAGTCACAGTGG + Intronic
1033319570 7:140327331-140327353 CAACCATTCTGGAGCCAGGAAGG - Intronic
1033879396 7:145862544-145862566 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1034572202 7:151965057-151965079 AACCCAGGCAGGAGTCAGAGTGG - Intronic
1035292237 7:157846652-157846674 CACGCATGATGGAGCGAGAGAGG - Intronic
1035292242 7:157846692-157846714 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292247 7:157846732-157846754 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292252 7:157846772-157846794 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292257 7:157846812-157846834 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292267 7:157846892-157846914 CACACATGATGGAGTCAGAGAGG - Intronic
1035292291 7:157847092-157847114 CACACATGATGGAGTCAGAGAGG - Intronic
1035292296 7:157847132-157847154 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292306 7:157847212-157847234 CACACATGATGGAGTCAGAGAGG - Intronic
1035292335 7:157847452-157847474 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292340 7:157847492-157847514 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292345 7:157847532-157847554 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292350 7:157847572-157847594 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292355 7:157847612-157847634 CACACATGATGGAGTGAGAGAGG - Intronic
1035292367 7:157847742-157847764 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292372 7:157847782-157847804 CACGCATGATGGAGTGAGAGAGG - Intronic
1035292377 7:157847822-157847844 CACACATGATGGAGTGAGAGAGG - Intronic
1035292403 7:157848062-157848084 CACCCATGAGGGAGTGAGAGAGG - Intronic
1035292416 7:157848192-157848214 CACCCATGAGGGAGTGAGAGAGG - Intronic
1035292429 7:157848322-157848344 CACCCATGAGGGAGTGAGAGAGG - Intronic
1037774571 8:21824834-21824856 CTTTCTTGCTGGAGCCAGAGAGG - Intergenic
1037821069 8:22134787-22134809 AACACATGCTGGGGACAGAGGGG - Intergenic
1037929205 8:22867602-22867624 CAAGAAGGCTGGAGCCAGAGGGG - Intronic
1039159002 8:34595904-34595926 AGCCAAGGCTGGAGCCAGAGTGG + Intergenic
1039293857 8:36127781-36127803 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1040436846 8:47399315-47399337 CACCCATGCAGGTGCCAGGATGG + Intronic
1041097771 8:54366382-54366404 CTTCCATGCTGGAGCCCAAGAGG - Intergenic
1041211861 8:55559788-55559810 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1041297719 8:56376049-56376071 CACCCAGGCTGGAGTCAGTGAGG - Intergenic
1042880666 8:73485191-73485213 CACCCAGGCTGGAGTGATAGTGG + Intronic
1044009007 8:86968352-86968374 CACTCATGCTTGAGCAAGGGTGG - Intronic
1045516674 8:102865866-102865888 CCCCTATGCTGGAACCAGAAAGG - Intronic
1045823676 8:106371874-106371896 TTCCCCTGCTGGAGCCAGGGAGG - Intronic
1046958917 8:120089221-120089243 CACCCATGCCTGCGCCACAGTGG + Intronic
1049248813 8:141577327-141577349 CACCCACTCCAGAGCCAGAGAGG - Intergenic
1049576660 8:143392869-143392891 CAGCCCTGCTGGAGCCAGCCTGG + Intergenic
1050171555 9:2824749-2824771 CACACACGATGGCGCCAGAGTGG - Exonic
1050409744 9:5350780-5350802 CACCCATGGAGCAGCCACAGAGG + Intergenic
1050618318 9:7426406-7426428 TTCCCCTGCTGGAGCCAGAGAGG - Intergenic
1050630086 9:7549539-7549561 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1050660729 9:7880173-7880195 TTCCCCTGCTGGAGCCAGGGAGG + Intronic
1050892213 9:10837453-10837475 CACCCAGGCTGGAGTGACAGTGG - Intergenic
1051333104 9:16043113-16043135 CAAGGATGCTGAAGCCAGAGAGG + Intronic
1051842612 9:21415238-21415260 CTCCCATGCTGGAGTCACTGAGG - Intronic
1052546632 9:29888896-29888918 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1053572912 9:39328569-39328591 CACCCAGGCTGGATGCAGTGGGG - Intergenic
1053731595 9:41062336-41062358 CACACATGCTGGAGAGATAGAGG + Intergenic
1054094475 9:60887278-60887300 CACCCAGGCTGGATGCAGTGGGG - Intergenic
1054115946 9:61163190-61163212 CACCCAGGCTGGATGCAGTGGGG - Intergenic
1054124232 9:61290442-61290464 CACCCAGGCTGGATGCAGTGGGG + Intergenic
1054591811 9:67019354-67019376 CACCCAGGCTGGATGCAGTGGGG + Intergenic
1057124084 9:92602559-92602581 CAGCCATGCTGGGGCCTGAGGGG + Intronic
1057853190 9:98581078-98581100 CACCGATGGTGGAGGCAGTGAGG + Intronic
1057896311 9:98911943-98911965 CAACCCTACTGGAGCAAGAGGGG + Intergenic
1058828105 9:108793061-108793083 CACTCCTGCTAGAGCCAAAGTGG + Intergenic
1060301371 9:122376261-122376283 CACCCCTGCTGGGGCCATTGTGG + Intronic
1060494892 9:124111440-124111462 CACCTAAGATGGAGCCAGAGAGG + Intergenic
1060568273 9:124613619-124613641 CACCCAGGCTGGAGTGAAAGTGG - Intronic
1061282950 9:129607875-129607897 CACCCGTGCTGGGCCCTGAGTGG - Intergenic
1061888602 9:133605939-133605961 TCCCCATGGTGCAGCCAGAGAGG + Intergenic
1062523534 9:136969363-136969385 CACCCATGCTGGGCACACAGTGG + Exonic
1062600773 9:137317753-137317775 CACCCAGGCTGGGGACAAAGAGG - Intronic
1203435432 Un_GL000195v1:132734-132756 CACACTTGCTGGAGCACGAGAGG - Intergenic
1186249305 X:7648874-7648896 CAATCATGTTGGAGACAGAGTGG + Intergenic
1186467781 X:9797520-9797542 CACCCATGCTGGAAGGAGTGAGG + Intronic
1188092144 X:25977059-25977081 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1190529592 X:51361583-51361605 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1192026333 X:67456744-67456766 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic
1192716430 X:73647514-73647536 TTCCCCTGCTGGAGCCAGGGAGG + Intronic
1192930268 X:75799327-75799349 TTCCCCTGCTGGAGCCAGAGAGG - Intergenic
1193039296 X:76987642-76987664 CTCCCCTGCTGGAGCCAGAGGGG + Intergenic
1194058212 X:89163823-89163845 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1195147162 X:102029324-102029346 TTCCCCTGCTGGAGCCAGAGAGG + Intergenic
1196517286 X:116628614-116628636 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1199471197 X:148198297-148198319 CCCCCATCCTAGAACCAGAGAGG - Intergenic
1200742029 Y:6864283-6864305 TTCCCCTGCTGGAGCCAGGGAGG - Intergenic
1201979640 Y:19892885-19892907 TTCCCCTGCTGGAGCCAGGGAGG + Intergenic