ID: 1183108010

View in Genome Browser
Species Human (GRCh38)
Location 22:35628501-35628523
Sequence CTGTGTTAGCAGAATAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183108010_1183108019 29 Left 1183108010 22:35628501-35628523 CCATCCTTATTCTGCTAACACAG 0: 1
1: 0
2: 3
3: 14
4: 263
Right 1183108019 22:35628553-35628575 CAAAACATCCTGAATTTATCTGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183108010 Original CRISPR CTGTGTTAGCAGAATAAGGA TGG (reversed) Intronic
902154193 1:14470663-14470685 CTTTGTTTGCAGGAAAAGGAAGG + Intergenic
903001406 1:20268694-20268716 CTGTCTTATCATAATGAGGAGGG + Intergenic
905014919 1:34771290-34771312 CTGAGTGGGCAGAATAAGTAAGG - Intronic
906350805 1:45057281-45057303 CTGTCTTAGCAGAATGCTGAGGG + Intronic
906891452 1:49720015-49720037 CTTTATTAGCAGCATAAGAATGG + Intronic
908766597 1:67559945-67559967 TTGTGTTGGGAGAATCAGGAAGG - Intergenic
910712862 1:90199751-90199773 CTGTGTTAGGTTAATAAGGCAGG - Intergenic
914965505 1:152253837-152253859 CTTTATTAGCAGCATAAGAATGG + Intergenic
916662750 1:166937046-166937068 CTGTAGCATCAGAATAAGGATGG + Intronic
917498117 1:175561039-175561061 CTGAATTAGAAGAACAAGGAAGG - Intronic
920186024 1:204159989-204160011 CTGAGTTCACAGAAAAAGGAAGG + Intronic
920784177 1:209024679-209024701 CTTTATTAGCAGAGTAAGAATGG + Intergenic
921739460 1:218667305-218667327 CTGTTTTAAAAGAACAAGGAAGG + Intergenic
923387343 1:233478359-233478381 CTTTATTAGCAGCATAAGGATGG - Intergenic
924703186 1:246474925-246474947 CTGTGCTATCAGATTAAGGAGGG + Intronic
1063507054 10:6609137-6609159 CTGAGGTAGCAGAGAAAGGAGGG + Intergenic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1069614769 10:69800151-69800173 ATCAGTTTGCAGAATAAGGAGGG + Intergenic
1073821911 10:107273840-107273862 ATGTGGTAGCAGAAAAAGCAAGG + Intergenic
1076923991 10:133472136-133472158 CTGTGTGAGCTGACAAAGGAGGG + Intergenic
1080184035 11:29457794-29457816 CTTTATTAGCAGCATAAGAATGG + Intergenic
1080423329 11:32132797-32132819 CTTTATTAGCAGCATAAGAATGG + Intergenic
1080928256 11:36781186-36781208 CGGTGATATCAGAAGAAGGAAGG - Intergenic
1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG + Intronic
1082677495 11:56124800-56124822 CTGTGTTTCCAGAATATGTAAGG - Intergenic
1084298564 11:68229658-68229680 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1085554843 11:77410905-77410927 TTAACTTAGCAGAATAAGGAAGG + Intronic
1086334183 11:85783083-85783105 CTTTATTAGCAGCATAAGAATGG - Intronic
1087529773 11:99364930-99364952 CTCTGGTACCTGAATAAGGATGG + Intronic
1087648823 11:100840153-100840175 CTGTTTTAAAAGAATATGGAGGG - Intronic
1087675777 11:101159307-101159329 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1091535200 12:1400794-1400816 GTGTGTTATCAGCATAAAGATGG - Intronic
1092697485 12:11189750-11189772 CTGTGTTTGCATAATAGTGAAGG - Intergenic
1093020340 12:14197639-14197661 CTGGAATAGAAGAATAAGGAGGG + Intergenic
1095241132 12:39860101-39860123 CTGTGTTAGCTAAAAAAGGAAGG + Intronic
1097473569 12:60025552-60025574 TTGTGTTAGTAGGATAGGGAAGG + Intergenic
1098509288 12:71292658-71292680 CTTTGTTAGCAGCATAAGAATGG - Intronic
1098696907 12:73571211-73571233 CTTTGGTACCAGACTAAGGATGG - Intergenic
1099218125 12:79878529-79878551 CTTTATTAGCAGCATAAGAACGG - Intronic
1099389052 12:82055841-82055863 CTGGGTCACCAGGATAAGGAGGG + Intergenic
1099891502 12:88593792-88593814 CTTTATTAGCAGCATAAGAAAGG + Intergenic
1100378852 12:94043228-94043250 CTTTATTAGCAGAATGAGAATGG - Intergenic
1100406163 12:94274475-94274497 CTTTGTTAGCAGAGGAGGGATGG + Intronic
1100602883 12:96127336-96127358 CTGTGATTGCAGCACAAGGATGG - Intergenic
1102397620 12:112600803-112600825 CTTTATTAGCAGCATGAGGACGG - Intronic
1103118328 12:118357391-118357413 ACGTGTTAGCAGAAAAAAGATGG - Intronic
1103264751 12:119619282-119619304 CTTTATTAGCAGCATAAGAATGG + Intronic
1104190286 12:126475607-126475629 CTTTATTAGCAGAATGAGAATGG - Intergenic
1106899285 13:34338030-34338052 CTGTATTATCACAGTAAGGAGGG - Intergenic
1108796022 13:54032387-54032409 CTTTATTAGCAGCATAAGAAGGG - Intergenic
1109808322 13:67473315-67473337 ATGTGTTTGCATAATAAAGAAGG - Intergenic
1111644922 13:91020463-91020485 CTGTCTTACCAGAATAAGGAAGG + Intergenic
1113133257 13:107061357-107061379 CTTTATTAGCAGCATAAGAATGG - Intergenic
1113945733 13:114043116-114043138 CTGAGTTTGCAGACAAAGGAGGG - Intronic
1114766929 14:25383243-25383265 CTGTGTTGGAAGAATAATTATGG + Intergenic
1115010487 14:28539492-28539514 CTTTATTAGCAGCATAAGAATGG + Intergenic
1118222483 14:63867936-63867958 CTGTGTTGGGAGACTAAGGTGGG + Intronic
1119937330 14:78603923-78603945 CTTTATTAGCAGCATAAGAACGG - Intronic
1121515580 14:94547808-94547830 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1121885855 14:97542174-97542196 GTGTGTTAGCAGAAGCTGGAGGG - Intergenic
1121980925 14:98452903-98452925 CTTTATTAGCAGCATAAGAATGG - Intergenic
1122013908 14:98777135-98777157 CAGTGGCAGCAGAATATGGATGG + Intergenic
1124357445 15:29006488-29006510 CTGTATTAGCAGCATGAGAATGG - Intronic
1124915684 15:33970567-33970589 CTGTAATACCATAATAAGGAGGG - Intronic
1125165048 15:36693435-36693457 CAGTGTTAGCAACATAAGGTTGG - Intronic
1126033655 15:44526230-44526252 CTGTTTGAGCATAAAAAGGAAGG - Exonic
1126361260 15:47848327-47848349 CTGTCTTCTCAGAATTAGGAAGG + Intergenic
1127484504 15:59406824-59406846 CTGGCTTAGCACAAGAAGGAAGG + Intronic
1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG + Intergenic
1130795223 15:87200807-87200829 CTGTGATAGCAGCATGAAGATGG + Intergenic
1131842209 15:96449521-96449543 CTGTGTTGACAAAATAAGCAGGG - Intergenic
1131862669 15:96670717-96670739 CGGCGTTAGCAGAAACAGGAAGG - Intergenic
1131905030 15:97133756-97133778 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1133486197 16:6221591-6221613 CTTTATTAGCAGTATAAGAATGG - Intronic
1134030045 16:10984764-10984786 CTGAGTCAGCAGAATCAGCAGGG + Intronic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1138714915 16:59009810-59009832 CTTTATTAGCAGCATAAGAATGG - Intergenic
1139254775 16:65530446-65530468 CTTTATTAGCAGCATAAGAATGG - Intergenic
1140986548 16:80163381-80163403 CTGTGTACGCAGAATAACGACGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1142227350 16:88884119-88884141 CTGTATTAGCAGAATCGGGTGGG + Intronic
1145757725 17:27404925-27404947 CTTTATTAGCAGCATAAGAATGG - Intergenic
1146624964 17:34428135-34428157 GAGTGTGAGCAGAATAGGGATGG - Intergenic
1146709974 17:35032554-35032576 CTGTGTGTGGAGAATAGGGACGG + Intronic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152661556 17:81544676-81544698 CTGTGTGTGCAGAATAAGCCCGG - Intronic
1153960768 18:10138157-10138179 CTGTGTAATCAGAATATGGTAGG - Intergenic
1154959336 18:21292270-21292292 CTGTGTTAGGAGGATAAAGCTGG + Intronic
1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG + Intergenic
1156130401 18:33965828-33965850 CTTTATTAGCAGCATAAGAATGG + Intronic
1156808419 18:41216435-41216457 CTGTGTTAGCAAAATATGCTGGG + Intergenic
1157671943 18:49538065-49538087 CTGTGTTTGCAGTTTAAGCAAGG - Intergenic
1158140245 18:54247537-54247559 CTGAGTTAGTAGAATCTGGAGGG + Intergenic
1159178982 18:64876890-64876912 CTTTATTAGCAGAATGAGAATGG - Intergenic
1159507755 18:69358441-69358463 CTGTGTCATCAAAAAAAGGAAGG - Intergenic
1159543743 18:69814086-69814108 CTCTGGTAGCAGAGTAGGGATGG + Intronic
1159952060 18:74491865-74491887 CTCTGCTTGCAGAATAAAGAGGG + Intergenic
1161762604 19:6185470-6185492 CTGTTCCAGCAGAACAAGGATGG + Exonic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163216858 19:15885448-15885470 GAGTGTTTGCTGAATAAGGATGG + Intronic
1163799393 19:19355614-19355636 CTGTGTGAGCAGCCCAAGGAAGG + Intronic
1164438530 19:28253304-28253326 CTGTTTTACCAAAAGAAGGATGG - Intergenic
1166047705 19:40239050-40239072 GTGTGTGTGCAGAATAAGCAGGG - Intronic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
926425784 2:12737308-12737330 CTGTTTTAGCAGAATAGCTATGG - Intronic
927069106 2:19507321-19507343 CTGTGATAGCATACTAAAGATGG - Intergenic
927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG + Intergenic
927400602 2:22706270-22706292 CTTTATTAGCAGTATAAGAATGG - Intergenic
927579428 2:24228730-24228752 CTGTGTCAGCAGAACAAAAAGGG + Intronic
928260689 2:29763956-29763978 CTGTGAGAGCAGAATAAACAGGG - Intronic
929110514 2:38402792-38402814 CTGAGTTAGGAGAATCAGGCAGG - Intergenic
930525156 2:52519536-52519558 CTGTATTAGCAGCATGAGAATGG + Intergenic
930926664 2:56826563-56826585 CTGAATTAGAAGAATAAAGATGG + Intergenic
931451650 2:62372207-62372229 GTGTGTCAGCAGAATAAAGTAGG - Intergenic
932431736 2:71679604-71679626 CTCAGAGAGCAGAATAAGGATGG - Intronic
932440828 2:71733771-71733793 CTTTGTTAGCAGCATGAGAATGG - Intergenic
936856249 2:116961057-116961079 CTTTTTTAGCAGAATATTGAAGG + Intergenic
939094630 2:137820739-137820761 CTTTGTTAGCAGCATGAGCATGG - Intergenic
939397925 2:141655305-141655327 GTGTGGTAGAATAATAAGGAAGG + Intronic
939667267 2:144966614-144966636 CTTTGTTAGCAGCAAAAGAAAGG + Intergenic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
940561769 2:155305786-155305808 CTGTATTAGCAGCATGAGAATGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942308700 2:174633919-174633941 TTGTGTTAGTAAAAGAAGGAAGG + Intronic
943006388 2:182392114-182392136 CTTTATTAGCAGCATAAGAATGG - Intronic
943220273 2:185094882-185094904 CTTTATTAGCAGCATAAGAATGG + Intergenic
943451201 2:188044411-188044433 CTGTGTGAGCAGGATAAAGCAGG + Intergenic
943863425 2:192896357-192896379 CATTGTTAAAAGAATAAGGAAGG + Intergenic
943904104 2:193475741-193475763 ATCTTTTAGCAGAAAAAGGAGGG + Intergenic
945002765 2:205369299-205369321 CTGAATTAGGAGAATAAGGGTGG - Intronic
945229697 2:207573082-207573104 CTGAGTTGCCAGAATAAAGAGGG - Intronic
948228952 2:236335713-236335735 CTGTGTTAATGGAATAAGGTAGG - Intronic
1168918681 20:1512912-1512934 CTTTATTAGCAGCATAAGAATGG - Intergenic
1169641332 20:7755905-7755927 CTGGGATAGCATAATAAGGAGGG - Intergenic
1173924435 20:46770342-46770364 CTTTATTAGCAGCATGAGGATGG - Intergenic
1176658030 21:9605459-9605481 CTTTGTTAGCAGTGTAAGAATGG + Intergenic
1177558540 21:22721039-22721061 CTGGGTTAGAAGAATAAGGATGG + Intergenic
1178274942 21:31228731-31228753 CTTTGTTAGCAGCATGAGAATGG - Intronic
1178791450 21:35704173-35704195 CTGTGTGAACACAAGAAGGAAGG - Intronic
1179052841 21:37903462-37903484 CTTTGTTAGCAGCATGAGAATGG + Intronic
1183008540 22:34925278-34925300 CTGGGTTATAAGAATATGGAAGG - Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
949768984 3:7557798-7557820 CTGTCTTAAGAGAACAAGGAGGG - Intronic
951064289 3:18246413-18246435 CTGTGTAAGCAGAACAAGAGAGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951420464 3:22478182-22478204 CTGTGAAAGCAAAATAAGGTAGG - Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
954892471 3:53943795-53943817 CTCTCTGAGCAGTATAAGGATGG - Intergenic
957586991 3:82145800-82145822 CTCTTTTAGCAGAAAAGGGATGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
960092686 3:113657526-113657548 CTGAGTTTGAAGAATTAGGAGGG + Exonic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
963961501 3:151314312-151314334 CTGTGTTTGCCATATAAGGAGGG + Intronic
964507313 3:157413564-157413586 CTGTGTCACCTGAAGAAGGAGGG - Intronic
965224715 3:165973079-165973101 CTTTATTAGCAGCATAAGAACGG + Intergenic
965425584 3:168518653-168518675 CTTTATTAGCAGAATGAGAATGG - Intergenic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
968173850 3:196531643-196531665 TTGTGTTTGCAGAACAAGGACGG - Intergenic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
970075282 4:12211618-12211640 CTTTGTTAGCAGTGTAAGAACGG - Intergenic
970413861 4:15837314-15837336 CTCTGTTATCAGAAAAAGAAAGG - Intronic
970582560 4:17486885-17486907 CTGTGTTAACTGCATAGGGAGGG - Exonic
971885072 4:32434446-32434468 CTGTGGTAAAAGAATAAAGAAGG - Intergenic
973945155 4:55948204-55948226 CTGAGGCAGCAGAATAGGGAAGG - Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
975495258 4:75029637-75029659 CTTTGTTAGCAGCATGAGAATGG + Intronic
975757282 4:77583339-77583361 CTGTGTTGGGAGATGAAGGATGG - Intronic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
978017308 4:103760724-103760746 CTTTGTTAGCAGCATTAGAATGG + Intergenic
979112027 4:116770831-116770853 CTCTATTAGCAGAACGAGGAGGG - Intergenic
979132166 4:117060804-117060826 CTGTGCAAACAGAATAAGGTAGG + Intergenic
979344272 4:119568058-119568080 CTAGGATAGCAGAACAAGGAAGG + Intronic
979741743 4:124159560-124159582 CTTTATTAGCAGTATAAGAACGG + Intergenic
980449919 4:132958187-132958209 CTGTGTCATGAGGATAAGGAGGG + Intergenic
980659887 4:135843685-135843707 CTTTATTTGCAGAATAAGTATGG + Intergenic
982308141 4:153955055-153955077 CTGTGTCAGCAGAATGAGTTGGG - Intergenic
985647561 5:1092186-1092208 CTGTGTTTACAGTAAAAGGAAGG + Intronic
985925439 5:3012542-3012564 CTGTGTCTGTAGAATCAGGATGG - Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987474400 5:18373091-18373113 CTTTGGAAGCAGAATCAGGAGGG + Intergenic
987643261 5:20638308-20638330 CTGAGTTAGAAGAATAAAGCTGG + Intergenic
988272526 5:29034891-29034913 TTGTGTTAGAAGAATCAGGGTGG - Intergenic
989340333 5:40367292-40367314 CTTTATTAGCAGCATAAGAAAGG - Intergenic
989523753 5:42429059-42429081 CTTTGTTAGCAGCATGAGAATGG - Intronic
989563904 5:42881958-42881980 TTCTATTAGCAGAAGAAGGAGGG - Intronic
990160161 5:52929233-52929255 CTGAGATAGCAGAACCAGGAAGG + Intronic
990165482 5:52989258-52989280 CGGTGTTTGCGGAATCAGGAGGG + Intergenic
990336358 5:54776568-54776590 CTTTCTTAGCAGAATGAGAATGG - Intergenic
990452671 5:55950614-55950636 CTGTGCTAGCAGAAAAAGTATGG + Intronic
990729729 5:58795297-58795319 CTTTATTAGCAGTATAAGAACGG + Intronic
993873632 5:93280737-93280759 ATTTGTTAGCAGAATGAGGCAGG + Intergenic
994450135 5:99930343-99930365 ATGTGGTGGCAGAATAAAGAGGG - Intergenic
994542434 5:101116888-101116910 CTTTGTTAGCAGCATGAGAATGG + Intergenic
996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG + Intergenic
997692752 5:135837840-135837862 CTTTATTAGCAGAATAAGAATGG + Intronic
998411898 5:141917564-141917586 CTGTGTCAGAAGAAAAGGGATGG + Intergenic
1000155049 5:158542048-158542070 CTGTTTTGGCAGATTCAGGAAGG + Intergenic
1000316619 5:160098493-160098515 CAGTGTTACCAAACTAAGGATGG + Intronic
1000412774 5:160950880-160950902 CTGTGTACTCAGAATAAGAAAGG + Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001663908 5:173416700-173416722 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1001876857 5:175209101-175209123 CTGTGTTATCTGAATAAATATGG + Intergenic
1003472565 6:6450846-6450868 CTGAGTTATCAGCAGAAGGATGG + Intergenic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1004803366 6:19175376-19175398 CTCTGTTAACTGAATACGGATGG - Intergenic
1004813629 6:19288322-19288344 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1005391121 6:25334233-25334255 CTGTGTGTCCAGAATCAGGAAGG - Intronic
1006721553 6:36156341-36156363 CTTTATTAGCAGCATAAGAACGG - Intergenic
1008096047 6:47340547-47340569 GTGTGGTTGCAGAGTAAGGAAGG + Intergenic
1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG + Intergenic
1010160728 6:72851115-72851137 ATGTATTATCAGATTAAGGATGG + Intronic
1014154372 6:118093699-118093721 CTTTATTAGCAGCATAAGAATGG + Intronic
1014330826 6:120061412-120061434 CTGTATTAGCAGCATGAGAATGG - Intergenic
1014723747 6:124950796-124950818 CTTTATTAGCAGCATAAGAATGG + Intergenic
1014742312 6:125160148-125160170 CTTTATTAGCAGCATAAGAATGG + Intronic
1016682454 6:146846106-146846128 CTGTATTAGCAGCATGAGAATGG - Intergenic
1016873236 6:148839272-148839294 CTGAGTCAGCATAATCAGGAAGG + Intronic
1018093760 6:160367084-160367106 CTTTATTAGCAGCATAAGAATGG - Intronic
1018294203 6:162328412-162328434 CTGTGTTCACAGAACAAGCAGGG - Intronic
1019034672 6:169044393-169044415 CTGTATTAGAAGAAAAAGAAAGG + Intergenic
1019052620 6:169194788-169194810 CTGTGTTACTGGAAAAAGGATGG - Intergenic
1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG + Intergenic
1022325038 7:29323413-29323435 CTGTGGTAGCAGAATAATGAGGG - Intronic
1022567485 7:31417604-31417626 CTGTGTTAGAAGACCAGGGATGG + Intergenic
1024631702 7:51254284-51254306 CTGTTTTAGAAGAAAATGGAAGG + Intronic
1025600318 7:62988724-62988746 CTGTTTTAGTAGAATAAGTGAGG + Intergenic
1027881338 7:83842210-83842232 CTCTGGTAACAGAATAAGAACGG - Intergenic
1028635758 7:92987524-92987546 CTATGTTAGCATAATAGGGCAGG - Intergenic
1029576858 7:101409121-101409143 CTTAGGTAGCAGAATGAGGAGGG + Intronic
1030016661 7:105229477-105229499 TTATGTTAGCACAAAAAGGATGG - Intronic
1030870213 7:114746590-114746612 CTGTGTTATCAGAATTAGCAGGG + Intergenic
1031888241 7:127263069-127263091 CTGTTTTAGCAGCATGTGGAGGG + Intergenic
1034026194 7:147707585-147707607 CTGTGTTAGCAGGCTCAGGCAGG + Intronic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1036062781 8:5342744-5342766 CTGTGTCTGCAGAATATGGAGGG + Intergenic
1037203537 8:16286644-16286666 CTATGTTTGCAGAAAAAGTAAGG + Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037752886 8:21694194-21694216 CTGTCTTAAGAGAGTAAGGAAGG + Intronic
1039756490 8:40528888-40528910 TTTTGTGACCAGAATAAGGAGGG - Intergenic
1042041747 8:64599035-64599057 TTGTTTTAGCTGAAAAAGGAAGG + Intronic
1044655832 8:94547443-94547465 CAGGGATAGAAGAATAAGGAAGG - Intronic
1045367055 8:101486070-101486092 CAGTGATAGAAGAGTAAGGAAGG - Intergenic
1048380899 8:133863919-133863941 CTGTCGTATTAGAATAAGGAAGG - Intergenic
1048582195 8:135738739-135738761 CTGTATTAGCAGCATAAGAACGG + Intergenic
1050188183 9:2997203-2997225 CAGAGTTAGGAGAATAAAGAAGG - Intergenic
1054771712 9:69089780-69089802 CTGTGTTAGCAGCGTCTGGATGG + Intronic
1057218364 9:93242148-93242170 CTGTGATAGCACAGTGAGGATGG + Intronic
1057870897 9:98716430-98716452 CAGTGTTAGCAGAGTCAGCATGG - Intergenic
1059801465 9:117753527-117753549 CTTTATTAGCAGCATAAGAAAGG - Intergenic
1203635759 Un_KI270750v1:109034-109056 CTTTGTTAGCAGTGTAAGAATGG + Intergenic
1186057965 X:5671602-5671624 CTTTATTAGCAGAATGAGAATGG - Intergenic
1186541665 X:10407546-10407568 CGATGTTGCCAGAATAAGGAAGG + Intergenic
1186570185 X:10706696-10706718 CTTTATTAGCAGCATAAGAATGG + Intronic
1187002061 X:15192101-15192123 CTGAGTTAGCAGAGAAAAGAAGG + Intergenic
1187827752 X:23349477-23349499 CTTGGTTAGCAGAATTAGCAGGG - Intronic
1188054689 X:25527528-25527550 CTTTATTAGCAGAATGAGAACGG - Intergenic
1188488523 X:30710332-30710354 CTAGGTTAGCAGATGAAGGAAGG - Intronic
1190679683 X:52814349-52814371 CTGTGTTAATAGGATATGGAAGG + Intronic
1192794304 X:74413252-74413274 CTGAGTTAGGAGAATCAGGCAGG + Intergenic
1193278176 X:79615753-79615775 CTTTATTAGCAGCATAAGAACGG + Intergenic
1194339924 X:92695012-92695034 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1194455970 X:94104203-94104225 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1196294529 X:113982941-113982963 CTGTATTTGCAAAATAAGGCTGG - Intergenic
1197975109 X:132158633-132158655 CTTTGTTATCAGAATGAGGCTGG + Intergenic
1197995349 X:132366877-132366899 CTTTATTAGCAGCATGAGGATGG - Intergenic
1198097968 X:133399095-133399117 CTGGTTTAGCAAAATATGGATGG - Intronic
1198119969 X:133582778-133582800 CTGTGTGGGCAGAATCAGAAGGG + Intronic
1198585693 X:138118280-138118302 CTGTGTTAGCAAAAATATGAAGG - Intergenic
1198826259 X:140701250-140701272 ATGCCTCAGCAGAATAAGGAAGG + Intergenic
1199595982 X:149506050-149506072 CTGTGTTTGCAGTATTAGGACGG - Intronic
1199909271 X:152268545-152268567 CTTTATTAGCAGCATAAGAATGG + Intronic
1200648310 Y:5811795-5811817 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1200691845 Y:6313421-6313443 CTTGGTTAGCAGAAATAGGAGGG - Intergenic
1200950689 Y:8896605-8896627 CCTTGTTAGCAGAAATAGGAGGG + Intergenic
1201043427 Y:9861302-9861324 CTTGGTTAGCAGAAATAGGAGGG + Intergenic
1201589879 Y:15603391-15603413 CTTTATTAGCAGAATGAGAATGG - Intergenic
1201665097 Y:16442619-16442641 CTTTATTAGCAGGATAAGAATGG + Intergenic