ID: 1183113902

View in Genome Browser
Species Human (GRCh38)
Location 22:35674817-35674839
Sequence AAAGCAAGAAAAGCACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183113902_1183113909 20 Left 1183113902 22:35674817-35674839 CCTTCCTGTGCTTTTCTTGCTTT No data
Right 1183113909 22:35674860-35674882 TAAGTCATTAGACTACCTGCTGG No data
1183113902_1183113911 22 Left 1183113902 22:35674817-35674839 CCTTCCTGTGCTTTTCTTGCTTT No data
Right 1183113911 22:35674862-35674884 AGTCATTAGACTACCTGCTGGGG No data
1183113902_1183113910 21 Left 1183113902 22:35674817-35674839 CCTTCCTGTGCTTTTCTTGCTTT No data
Right 1183113910 22:35674861-35674883 AAGTCATTAGACTACCTGCTGGG No data
1183113902_1183113908 -6 Left 1183113902 22:35674817-35674839 CCTTCCTGTGCTTTTCTTGCTTT No data
Right 1183113908 22:35674834-35674856 TGCTTTGGGGGCTGAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183113902 Original CRISPR AAAGCAAGAAAAGCACAGGA AGG (reversed) Intergenic
No off target data available for this crispr