ID: 1183113911

View in Genome Browser
Species Human (GRCh38)
Location 22:35674862-35674884
Sequence AGTCATTAGACTACCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183113905_1183113911 18 Left 1183113905 22:35674821-35674843 CCTGTGCTTTTCTTGCTTTGGGG No data
Right 1183113911 22:35674862-35674884 AGTCATTAGACTACCTGCTGGGG No data
1183113902_1183113911 22 Left 1183113902 22:35674817-35674839 CCTTCCTGTGCTTTTCTTGCTTT No data
Right 1183113911 22:35674862-35674884 AGTCATTAGACTACCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183113911 Original CRISPR AGTCATTAGACTACCTGCTG GGG Intergenic
No off target data available for this crispr