ID: 1183114834

View in Genome Browser
Species Human (GRCh38)
Location 22:35683388-35683410
Sequence CCTTATATGCAGATTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183114827_1183114834 11 Left 1183114827 22:35683354-35683376 CCTTGAACAACATGGGTTTGAAC 0: 189
1: 454
2: 688
3: 755
4: 704
Right 1183114834 22:35683388-35683410 CCTTATATGCAGATTGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183114834 Original CRISPR CCTTATATGCAGATTGGAGA AGG Intergenic
No off target data available for this crispr