ID: 1183116382

View in Genome Browser
Species Human (GRCh38)
Location 22:35695539-35695561
Sequence GTGTACACCCACTGCGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183116369_1183116382 17 Left 1183116369 22:35695499-35695521 CCTCTCCCTCCCAGGATATAAGG No data
Right 1183116382 22:35695539-35695561 GTGTACACCCACTGCGATATTGG No data
1183116372_1183116382 12 Left 1183116372 22:35695504-35695526 CCCTCCCAGGATATAAGGGACAA No data
Right 1183116382 22:35695539-35695561 GTGTACACCCACTGCGATATTGG No data
1183116375_1183116382 8 Left 1183116375 22:35695508-35695530 CCCAGGATATAAGGGACAAGGTC No data
Right 1183116382 22:35695539-35695561 GTGTACACCCACTGCGATATTGG No data
1183116373_1183116382 11 Left 1183116373 22:35695505-35695527 CCTCCCAGGATATAAGGGACAAG No data
Right 1183116382 22:35695539-35695561 GTGTACACCCACTGCGATATTGG No data
1183116376_1183116382 7 Left 1183116376 22:35695509-35695531 CCAGGATATAAGGGACAAGGTCA No data
Right 1183116382 22:35695539-35695561 GTGTACACCCACTGCGATATTGG No data
1183116367_1183116382 30 Left 1183116367 22:35695486-35695508 CCGCTAGTATCTTCCTCTCCCTC No data
Right 1183116382 22:35695539-35695561 GTGTACACCCACTGCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183116382 Original CRISPR GTGTACACCCACTGCGATAT TGG Intergenic
No off target data available for this crispr