ID: 1183116391

View in Genome Browser
Species Human (GRCh38)
Location 22:35695581-35695603
Sequence CATTTTTCCTAAAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183116391_1183116398 12 Left 1183116391 22:35695581-35695603 CCCTCTGCCCTTTAGGAAAAATG No data
Right 1183116398 22:35695616-35695638 TGTACACCCCCTGCTATATTGGG No data
1183116391_1183116397 11 Left 1183116391 22:35695581-35695603 CCCTCTGCCCTTTAGGAAAAATG No data
Right 1183116397 22:35695615-35695637 TTGTACACCCCCTGCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183116391 Original CRISPR CATTTTTCCTAAAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr