ID: 1183122407

View in Genome Browser
Species Human (GRCh38)
Location 22:35740162-35740184
Sequence CAGAGGGCACACGCTGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183122399_1183122407 25 Left 1183122399 22:35740114-35740136 CCTCATTTGCAAAGAAAGGTGCC 0: 1
1: 0
2: 4
3: 17
4: 164
Right 1183122407 22:35740162-35740184 CAGAGGGCACACGCTGGCTTAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1183122402_1183122407 4 Left 1183122402 22:35740135-35740157 CCAGGGACTCTATTACACTCACT 0: 1
1: 0
2: 3
3: 53
4: 199
Right 1183122407 22:35740162-35740184 CAGAGGGCACACGCTGGCTTAGG 0: 1
1: 0
2: 1
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183122407 Original CRISPR CAGAGGGCACACGCTGGCTT AGG Intronic
901188281 1:7388873-7388895 CACTGGGCACACCCTGGCTCTGG - Intronic
901190515 1:7407333-7407355 GGGAGGGCACAGGCTGTCTTGGG + Intronic
901776431 1:11563437-11563459 CTGAGGGCACAGGCTGTCTAAGG + Intergenic
902601014 1:17540124-17540146 CAGAGGGGAGACGCGGGCTCGGG - Intronic
903220364 1:21865827-21865849 CAGAGGTCACAGGCTGACCTTGG + Intronic
904045081 1:27603888-27603910 CAGAAAGCAGACGCTGGCTTTGG + Intronic
906211122 1:44012824-44012846 CAGAGGGCACACTCAGGCCGGGG - Intronic
907119113 1:51993027-51993049 GAAAGGGCACACACAGGCTTGGG + Intergenic
910112788 1:83700608-83700630 CAGAGGGCCCAGGCTGGATGTGG - Intergenic
916235037 1:162578289-162578311 CTGAGGGCACCTGCTGACTTGGG - Intronic
920440670 1:205978658-205978680 CAGAGGGCAGCCCCTGGCTCAGG - Exonic
1063218981 10:3948909-3948931 GTGAGGACACACTCTGGCTTCGG - Intergenic
1064222650 10:13455248-13455270 GAAAGGGCACAGGCTGGGTTGGG + Intronic
1067779530 10:49189633-49189655 CAGAGGGCACATGCAGCCTGAGG - Intergenic
1069637829 10:69936338-69936360 CAGAGGACACACAGTGCCTTGGG - Intronic
1070611413 10:77935494-77935516 CAGAGGCCCCACTCTGGCCTTGG + Intergenic
1074975808 10:118580760-118580782 CAGAGGGCATGGGTTGGCTTGGG + Intergenic
1076082475 10:127595522-127595544 CAGAGGGCACAGTCTGGGGTTGG + Intergenic
1077029766 11:459902-459924 CAGAGGGCACATGCTGCCACTGG - Intronic
1077520492 11:3030453-3030475 CAGAGCGCACACCCTGCTTTTGG - Intronic
1079233459 11:18669952-18669974 GAGAGGGGAAGCGCTGGCTTAGG + Intergenic
1080611305 11:33906419-33906441 CAGAGGCCACACGTTGCCTAGGG - Intergenic
1080638620 11:34145078-34145100 CACAGGGCCCATGATGGCTTTGG + Intronic
1080864444 11:36180784-36180806 CAATTGGCACACGCTGGCCTTGG - Intronic
1081726161 11:45330902-45330924 CAGAGGGAAAACACAGGCTTTGG - Intergenic
1083912729 11:65719635-65719657 GAAAGGGCCCATGCTGGCTTAGG + Exonic
1084285515 11:68128365-68128387 CAGCGGGCAGCCGCTGGCCTTGG - Intergenic
1084707124 11:70822045-70822067 GAAAGGGCACTCGCTGTCTTAGG - Intronic
1085564128 11:77497535-77497557 CAAGGGGCACAGCCTGGCTTAGG + Intergenic
1087826249 11:102767965-102767987 CAGGGACCAGACGCTGGCTTTGG - Intergenic
1088410863 11:109532919-109532941 CAGAGGGTAAACCCTGGCCTTGG + Intergenic
1091206270 11:133823380-133823402 CAGAGGGAACACGCTGCTTGTGG - Intergenic
1094078929 12:26511331-26511353 CAGAGGGCACAAACTGGGCTAGG - Intronic
1097809135 12:63999586-63999608 CAGAGGTGACACCCAGGCTTGGG + Intronic
1098124483 12:67276103-67276125 CAGAGGGAACAAACTGGGTTAGG - Intronic
1098471885 12:70854656-70854678 CAGAGGGTAGAGGCTGGCTCTGG + Intronic
1100224306 12:92540711-92540733 CAGTCGGCACACGCTGGCCCTGG + Intergenic
1101389628 12:104288815-104288837 CAGAGGGCACGCGGTGCCTGCGG + Intronic
1102072717 12:110035093-110035115 CAAAGGGAACATGCTTGCTTTGG - Intronic
1102904323 12:116662607-116662629 CGGAGGGCTCAGGCTGGCTGTGG - Intergenic
1102988082 12:117294712-117294734 CACAGGGCACAAGTGGGCTTTGG + Intronic
1103148665 12:118617829-118617851 GAGAGGGCACATGTTGACTTTGG - Intergenic
1104736659 12:131139453-131139475 AGGAGGGCCCACGCTGGCCTGGG - Exonic
1104751945 12:131245475-131245497 CAGAGGGCAGGCGCTGGCAATGG - Intergenic
1104779944 12:131413600-131413622 CAGAGGGCAGGCGCTGGCAATGG + Intergenic
1105469195 13:20676510-20676532 CAGAGGTCACACACTGGCAGTGG - Intronic
1107659929 13:42627948-42627970 CTGGGGTCACATGCTGGCTTTGG + Intergenic
1108213200 13:48158846-48158868 CAGAGGGCTCAGGCTGGGTGTGG - Intergenic
1113550028 13:111185610-111185632 CAGATGCAACACACTGGCTTGGG - Intronic
1113916245 13:113875696-113875718 GAGAGGGCACACGGTTGCTTGGG - Intergenic
1120146212 14:80981785-80981807 CAGAGGGCAGAGGCACGCTTGGG - Intronic
1122343417 14:101043552-101043574 CAGAGGGCACAGGCAGGCTCAGG - Intergenic
1122375467 14:101254123-101254145 GGGAGGGCACACCCTGACTTGGG + Intergenic
1202865606 14_GL000225v1_random:115068-115090 CACAGTGCACAGGCTGGCTGAGG - Intergenic
1202919292 14_KI270723v1_random:16136-16158 CAGAGGACCCACGCTGGCACTGG + Intergenic
1202925339 14_KI270724v1_random:18858-18880 CAGAGGACCCACGCTGGCACTGG - Intergenic
1126786329 15:52180145-52180167 CAGCGGGCAAACTGTGGCTTAGG + Intronic
1130942876 15:88525532-88525554 CACAGGGCAGACACTGGCCTTGG + Intronic
1131775393 15:95790915-95790937 CAGATGTCATATGCTGGCTTAGG + Intergenic
1132771737 16:1567383-1567405 CAGAGGGCAGAGGCCGGCATTGG - Intronic
1136592656 16:31226802-31226824 CTGAGGGAAGACGCTGGCCTGGG + Intergenic
1137618222 16:49858908-49858930 CAGATGGCACACGCTGGGGGAGG + Intergenic
1138558308 16:57785700-57785722 CAGAGGTCCCACGCTGGCAGAGG + Intronic
1140816452 16:78625330-78625352 CAAATGGAACACGCTGGCCTTGG - Intronic
1141829880 16:86504303-86504325 CAGAGGGAAGACGCCGGCTCAGG - Intergenic
1141900472 16:86987321-86987343 CTGAGGGCATACGCAGGCTGAGG + Intergenic
1141900484 16:86987410-86987432 CTGAGGGCATACGCAGGCTGAGG + Intergenic
1142000308 16:87660492-87660514 CAGAGGCCACAGGCTGGACTGGG + Intronic
1143855162 17:9842976-9842998 TAGAGGGCACTCTCTGGATTAGG - Intronic
1147121664 17:38338705-38338727 CACAGGGCTCGCCCTGGCTTTGG + Intronic
1147601777 17:41751085-41751107 CAGAGGGCAAATGCAGGCTTCGG - Intergenic
1147978928 17:44262941-44262963 CAGAGGGCACAGGCTGAGTGGGG + Intronic
1151164467 17:72192051-72192073 CAGTGGGGAGAGGCTGGCTTCGG - Intergenic
1152687533 17:81701921-81701943 CAGAGGGCACAGGCTGCTTGGGG - Exonic
1153755201 18:8275601-8275623 CATAGGGCACACGCTGCTATAGG + Intronic
1153794652 18:8610330-8610352 CAGACGGCGCGCGCTGGCCTTGG - Intronic
1160807556 19:999148-999170 CAGAGGACATAGGCAGGCTTGGG + Intergenic
1163292180 19:16386069-16386091 CACAGAGGCCACGCTGGCTTTGG + Intronic
1163378606 19:16949545-16949567 CAGCGGTCACAGGGTGGCTTCGG - Intronic
1165453215 19:35896953-35896975 CCGAGCTCACATGCTGGCTTTGG - Exonic
1165638585 19:37364593-37364615 CAGAGGGCTGTCGCTGGCTGTGG + Intronic
1166288819 19:41848763-41848785 CAGAGGGCACAGGCTGGAGTTGG - Intronic
1167487326 19:49770284-49770306 CAGAGGGGAGATGCAGGCTTGGG + Intronic
1168152621 19:54457000-54457022 CAGAGGCCACACGGGGGCTCTGG + Intronic
927340645 2:21979987-21980009 CAGAGGGCACATCTTTGCTTTGG + Intergenic
930937436 2:56970728-56970750 CTGAGGGCACGTGCTGGCTGGGG - Intergenic
933210792 2:79566259-79566281 CAGAAGGCACAATCTGGATTAGG - Intronic
941624642 2:167818018-167818040 CAGAGGGCTGAAGCTGCCTTTGG - Intergenic
942446823 2:176083611-176083633 CAGACGGCAGGCGCGGGCTTAGG + Exonic
943551135 2:189340472-189340494 AAGAGGCCACACTCTGGCCTGGG + Intergenic
947759488 2:232593423-232593445 CAGAGGGCACAAGCTGGAGAAGG + Intergenic
948166052 2:235863583-235863605 CAGGGGACAGACGCTGGCTGGGG + Intronic
1171254522 20:23679407-23679429 CTGAGGGACCAAGCTGGCTTGGG + Intergenic
1173758580 20:45539657-45539679 AAGAGGGCACATGTTGTCTTGGG + Intronic
1173857319 20:46258657-46258679 CAGGGGGCACACCCAGGGTTGGG - Intronic
1174163845 20:48570772-48570794 CAAAGGGCACACCTTGGCCTGGG + Intergenic
1174272771 20:49381600-49381622 TAGAGGACGCACGCTGCCTTAGG - Intronic
1174389388 20:50208412-50208434 CAGAGTCCACACGCTGGCCCAGG - Intergenic
1175182279 20:57157107-57157129 CACAGGGCCCACTCTGGCTGAGG + Intergenic
1175234759 20:57502174-57502196 CCGGGGGCACACCCAGGCTTAGG + Intronic
1175496516 20:59418267-59418289 CAGAGAGCAAACCCTGCCTTGGG + Intergenic
1175844746 20:62052520-62052542 CACAGGGCACACACGGGCTGGGG - Intronic
1175902055 20:62363816-62363838 CAGAGGGCACACTCTGGGCGAGG - Intronic
1175918142 20:62437076-62437098 CTGAGGGCACATGCTGGCCAAGG - Intergenic
1176082963 20:63283152-63283174 CAGATGGCCCACGCTGGCGGTGG + Intronic
1176285900 21:5019509-5019531 CAGAGTGCACACACTGGCCCTGG - Intergenic
1177772837 21:25536031-25536053 AAGAGGCCACAGGCTGGATTTGG - Intergenic
1178265992 21:31143024-31143046 CAGTGGACACACGCTGCCTCTGG + Intronic
1178807385 21:35850991-35851013 CAGAAGACACACCCTGGCTGAGG - Intronic
1179871281 21:44243966-44243988 CAGAGTGCACACACTGGCCCTGG + Intergenic
1180000118 21:44991731-44991753 CGGAAGACACACGCTGGCCTTGG - Intergenic
1180003986 21:45011522-45011544 TAGAGGTCACACCCTGGCTTCGG - Intergenic
1180833579 22:18918820-18918842 CAGAGGACACAGGGTGGCATGGG - Intronic
1181066250 22:20307434-20307456 CAGAGGACACAGGGTGGCATGGG + Intergenic
1182074090 22:27483189-27483211 GAGAGGGCACACACAGGTTTCGG + Intergenic
1182492534 22:30683024-30683046 CAACAGGCACATGCTGGCTTGGG - Intergenic
1183122407 22:35740162-35740184 CAGAGGGCACACGCTGGCTTAGG + Intronic
1184587927 22:45460367-45460389 CAGCGAGCACAGGCTGGGTTGGG - Intergenic
1184882919 22:47322915-47322937 CATGGGGCACACACTGGCCTAGG - Intergenic
1185042706 22:48513645-48513667 CACAGGGCAGACGCGGGCTCTGG - Intronic
1185072387 22:48663443-48663465 CAGCCGGCACACGGTGACTTAGG + Intronic
1185214853 22:49592926-49592948 CAGAGGGCCCTCCCTGGCGTGGG + Intronic
1203283664 22_KI270734v1_random:144118-144140 CAGAGGACACAGGGTGGCATGGG - Intergenic
957163982 3:76647013-76647035 AAAAGGGCACACGCTTGCCTAGG + Intronic
962939808 3:140115586-140115608 CAGAGGTGACAAGCTGGTTTGGG - Intronic
965408606 3:168301930-168301952 CTGAGGGCACAGGCTGGTTGTGG + Intergenic
968627435 4:1632970-1632992 CACAGGGCGCACGCAGGCATAGG + Intronic
968980186 4:3843781-3843803 CACAGAGCACACACTGGCTGCGG + Intergenic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
970220673 4:13807086-13807108 AGGAGGGCACCTGCTGGCTTCGG + Intergenic
972532754 4:39976537-39976559 CAGAGGGCAGTGGCAGGCTTGGG + Exonic
975389843 4:73803059-73803081 GAGAGGGCCCCCCCTGGCTTGGG + Intergenic
977399749 4:96517677-96517699 CAGAGGGGAAAAACTGGCTTTGG + Intergenic
979876117 4:125893326-125893348 CAGAGGGCATACCCTGGCTTAGG - Intergenic
984518098 4:180767107-180767129 CAGAGGGCACCGGCTGACTGTGG + Intergenic
985520586 5:372345-372367 CACAGGGCCCAGGCTGGATTTGG - Intronic
995324950 5:110879934-110879956 CTCAGGGCATACTCTGGCTTAGG + Intergenic
997193055 5:131957836-131957858 CTGAGGGCACACACTGGCTATGG + Intronic
997606509 5:135178956-135178978 CAGAGCGCACACGTTGACTGAGG + Intronic
998011581 5:138699644-138699666 CAGAGAGCAAAGGCTGGCGTGGG + Intronic
998896164 5:146802370-146802392 CTGAGGGCACTGCCTGGCTTTGG + Intronic
999887132 5:155936415-155936437 CAGAGAGCAGACGCTGGGGTGGG + Intronic
1000064472 5:157683138-157683160 CAACAGGCACATGCTGGCTTGGG - Intergenic
1002346736 5:178553191-178553213 CGAAGGGCACACGCTGTCTTGGG - Intronic
1003123590 6:3337709-3337731 CAGAGGCCACAGGCTGGGCTCGG + Intronic
1007730549 6:43942851-43942873 CAGAGAGCACAGGCTGCATTAGG + Intergenic
1008788866 6:55204291-55204313 CAGAGGGCACCCTCTGGATTAGG + Intronic
1008869667 6:56258295-56258317 CACAGGGCAGACTCTGACTTTGG - Intronic
1011695965 6:89912959-89912981 CAGAGGACAGAGGCTGCCTTGGG - Intergenic
1012985833 6:105875372-105875394 CAGAGGTCACAAGGTGGCTGTGG + Intergenic
1013596246 6:111663410-111663432 CAGAGGGAACACTCGGACTTCGG + Intronic
1016287231 6:142486824-142486846 CAGAGGTCACTCGGTGGCTCAGG + Intergenic
1019347238 7:537193-537215 CAGAGAAGACACGGTGGCTTTGG - Intergenic
1027168126 7:75850512-75850534 CAGTGAGCACACGCTGACTTAGG - Intronic
1027249971 7:76392995-76393017 CAAAGGTCACACGCTAGCTCTGG + Intronic
1032796556 7:135281889-135281911 AAGAGGTCACAGGCTGGATTTGG + Intergenic
1034556229 7:151852116-151852138 CACAGGGCACAGGCTTGCGTAGG - Intronic
1036823017 8:11955055-11955077 AAGAGGGCACACACTGGAGTTGG - Intergenic
1037562730 8:20089159-20089181 CAGAGGGGACCCTCTGTCTTGGG + Intergenic
1039124125 8:34181738-34181760 CATAGTGCACACGCTGGCCATGG - Intergenic
1040308988 8:46226939-46226961 CACAGGGCACAGGGTGGCGTGGG + Intergenic
1043279051 8:78439577-78439599 CAGAGGACCCACGCTGGCACTGG - Intergenic
1045013834 8:97981714-97981736 CAGACTGCACACACTGGCTGGGG + Intronic
1047601951 8:126434435-126434457 CAGAGAGAACACTCAGGCTTTGG - Intergenic
1047644639 8:126857222-126857244 CAGAGTGCACAAGCTCACTTGGG - Intergenic
1050132086 9:2423137-2423159 CAGAGGGCACACTCTGGGCAAGG + Intergenic
1052857894 9:33418356-33418378 CACAGGGCACTGGCTGGGTTGGG - Intergenic
1056858952 9:90161964-90161986 CAGAGTGCACACCATGGTTTGGG - Intergenic
1057294483 9:93827371-93827393 GAGAGGGCACACGCAGGCCAGGG + Intergenic
1058872203 9:109212330-109212352 CAGGGGGCACACGGTGCATTGGG + Intronic
1059957089 9:119528304-119528326 CAGGTGGCAAACACTGGCTTTGG - Intergenic
1060783491 9:126431066-126431088 CACATGGGACACGCTGGCTTGGG + Intronic
1061176107 9:128998332-128998354 CACAGGGCTCACGTTGGCCTGGG + Intronic
1061712481 9:132497794-132497816 CAGTGGGCACTTGCTGGGTTCGG - Intronic
1062161658 9:135083699-135083721 CATAGGGCACAGGCTGCCTGGGG + Intronic
1062255103 9:135617155-135617177 CTGAGGGCACAGGCAGCCTTGGG + Intergenic
1062264727 9:135681780-135681802 CTGAGGGCAGATGCTGGCTTGGG - Intergenic
1187346215 X:18466878-18466900 CAGAGGGCATTGGCTTGCTTGGG + Intronic
1195702305 X:107714781-107714803 CAGAGGGGCCACGATGGCTAAGG - Intronic
1200070792 X:153528068-153528090 CAGAGTGCAGGTGCTGGCTTTGG - Intronic
1201635916 Y:16123106-16123128 GAGAGGACATATGCTGGCTTAGG - Intergenic